ID: 1016379174

View in Genome Browser
Species Human (GRCh38)
Location 6:143456176-143456198
Sequence ATTTAGACACAGAGGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 572
Summary {0: 1, 1: 0, 2: 3, 3: 60, 4: 508}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016379169_1016379174 5 Left 1016379169 6:143456148-143456170 CCCAGTCTTTCATATTGAGGATG 0: 1
1: 0
2: 2
3: 28
4: 726
Right 1016379174 6:143456176-143456198 ATTTAGACACAGAGGGAGGAAGG 0: 1
1: 0
2: 3
3: 60
4: 508
1016379170_1016379174 4 Left 1016379170 6:143456149-143456171 CCAGTCTTTCATATTGAGGATGA 0: 1
1: 0
2: 1
3: 12
4: 173
Right 1016379174 6:143456176-143456198 ATTTAGACACAGAGGGAGGAAGG 0: 1
1: 0
2: 3
3: 60
4: 508

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016379174 Original CRISPR ATTTAGACACAGAGGGAGGA AGG Intronic
900648272 1:3718682-3718704 AGTTGGACACAGATGGAGTAAGG - Intronic
900704369 1:4070702-4070724 ATGTAGAATCAGAGAGAGGAAGG + Intergenic
901080503 1:6581165-6581187 AGTTTCCCACAGAGGGAGGAGGG - Exonic
901205324 1:7491437-7491459 GAGTAGACACAGAGGGAAGATGG + Intronic
901233043 1:7651860-7651882 ATTTAGAAACAGTGGGAGACCGG - Intronic
902046700 1:13530063-13530085 AGTTAGAGAGAGAGAGAGGAGGG - Intergenic
902697813 1:18152059-18152081 ATATAGCAACAGAGGGAGAAAGG - Intronic
903317278 1:22518048-22518070 ATATACACACACAGGAAGGAAGG + Intronic
903706490 1:25289604-25289626 ATTAACTCCCAGAGGGAGGAGGG + Intronic
903720749 1:25403754-25403776 ATTAACTCCCAGAGGGAGGAGGG - Intronic
904183912 1:28687732-28687754 ATAGAGACAGGGAGGGAGGATGG + Intronic
904250314 1:29218781-29218803 ATTTACACATAGCTGGAGGACGG + Intronic
904593913 1:31631048-31631070 ATTTGGAGAAAGAGGGATGAGGG - Intronic
905128246 1:35731305-35731327 AGTCAGACAAAGAAGGAGGATGG + Intronic
905222447 1:36458009-36458031 AGTTGGGCACAGAGGAAGGAAGG + Intronic
906221170 1:44080531-44080553 ATTAAGACACAGAGAGAGCCTGG - Intergenic
907336859 1:53705337-53705359 ATTTAGATGCAGAGTGAGGGAGG - Intronic
907394291 1:54178531-54178553 ATGTGGAGTCAGAGGGAGGAGGG + Intronic
908163711 1:61437006-61437028 ATTCAGACTCTGAGGAAGGAGGG - Intronic
909016832 1:70389042-70389064 ATTAAAGCAGAGAGGGAGGAAGG - Intergenic
909379487 1:74981946-74981968 ATTTAGGTAGAAAGGGAGGAAGG + Intergenic
909662416 1:78098791-78098813 ATTTAGACACAGACACAGGGAGG + Intronic
909928978 1:81473062-81473084 AATTAGAGATAGAGGGAGGGAGG + Intronic
910540653 1:88352470-88352492 ATTTAGACACAGGGAGAGCTTGG - Intergenic
910545206 1:88408106-88408128 ATTTTTACACAGATGAAGGAGGG + Intergenic
910581253 1:88827667-88827689 ATATAGAGAGAGAGAGAGGAGGG - Intronic
910908748 1:92211442-92211464 ATTTAGTCAAAGAGGGTGAATGG + Intergenic
911047411 1:93639787-93639809 ATTTAAAGACACAGGGAGGGAGG + Intronic
911656100 1:100445613-100445635 AGTTAGACAGAGAGGAAGGAAGG - Intronic
911716277 1:101137051-101137073 ATTGAGAGAGAGAGGGAGGGAGG - Intergenic
912001316 1:104838117-104838139 GTATAGATACAGTGGGAGGAGGG - Intergenic
912526925 1:110290386-110290408 ACACAGACACACAGGGAGGAAGG + Intergenic
914716571 1:150259219-150259241 AATAAGAGACAGAGAGAGGAAGG + Intronic
914910750 1:151784142-151784164 ATTTAGGCACAGGTGGAGGAAGG - Intronic
915116458 1:153603739-153603761 ATACAGAGACAGAGGGAGGGGGG - Intergenic
916264261 1:162874622-162874644 AGCAAGACACAGAGGGAAGATGG - Intergenic
916406916 1:164506918-164506940 ACTGAGACACAGGGGGAGCAGGG + Intergenic
916771434 1:167912633-167912655 ATACAGAGACAGAGGGAGGGGGG - Intronic
918404887 1:184201976-184201998 ATTTAGGCACAAAGTTAGGAAGG + Intergenic
919841078 1:201609850-201609872 ATAGAGAGAGAGAGGGAGGAGGG + Intergenic
919860627 1:201737533-201737555 GGTGAGACACACAGGGAGGAGGG + Intronic
920100549 1:203514497-203514519 ATTTAGCCACAGGGGGAGAAAGG - Intergenic
920368649 1:205462918-205462940 ACATAGACACAGAGAGAAGATGG - Intergenic
921693114 1:218176183-218176205 TTTTAGACATAGAGGGAAAACGG + Intergenic
921744823 1:218728151-218728173 ATTAAGTTACAGAGGGAGGTAGG + Intergenic
922507636 1:226135775-226135797 GTTTAGACACTGGGGGAGGGAGG - Intergenic
922544532 1:226446025-226446047 ACTTGGAGAGAGAGGGAGGAAGG - Intergenic
922550607 1:226491473-226491495 ATACAGAGACAGAGGGAGGGGGG + Intergenic
923504241 1:234591766-234591788 ATATAGAAACAGAAGGAGGCTGG - Intergenic
923566928 1:235083340-235083362 ATTTAGACACAGTGGCAGCTGGG + Intergenic
923749501 1:236734549-236734571 ATTAAGACACAGAAGGTGAAGGG - Intronic
924404437 1:243727882-243727904 ATTTAGGCATAGAGGGATGTTGG + Intronic
924465869 1:244298834-244298856 AATGTGACACAGAGGGAGGGAGG - Intergenic
924805154 1:247356053-247356075 ATTTCGACACAGAGAAAGAAAGG + Intergenic
1063539185 10:6914835-6914857 ATTCAGACACTGAGGGAAAAAGG + Intergenic
1064101861 10:12471038-12471060 AAAAAGACACAAAGGGAGGAAGG - Intronic
1064184177 10:13146473-13146495 ATGCACACAGAGAGGGAGGAAGG - Intergenic
1064296695 10:14085104-14085126 ATTTATAAACAGATGGAGGTGGG - Intronic
1064473314 10:15659766-15659788 ATGTAGACAGAGAGGGCAGAAGG + Intronic
1064796250 10:19014831-19014853 ACACAGACACAGAGGGAAGAAGG + Intergenic
1065736560 10:28758296-28758318 AAGTAGAGACAGAAGGAGGAAGG - Intergenic
1065781402 10:29171685-29171707 ATACAGAGACAGAGGGAGGGGGG + Intergenic
1065792167 10:29270626-29270648 GTTTAGACAGAGAGAGAGGACGG + Intergenic
1066110025 10:32187649-32187671 ATACAGAGACAGAGGGAGGGGGG + Intergenic
1066233908 10:33467193-33467215 TTTTAGAGTCAGAGGGAGGAGGG + Intergenic
1067696369 10:48538246-48538268 ACAGAGACACAGAGGGAGGAAGG - Intronic
1068260413 10:54573746-54573768 ATTTAAACACAGAGAGGGTAGGG - Intronic
1068878214 10:62020362-62020384 TTTTAAACACAGATGGGGGAGGG - Intronic
1069832386 10:71289236-71289258 ACTGAGTCACAGAGAGAGGAAGG + Intronic
1069835432 10:71305019-71305041 AAGTAGAGACAGAGGAAGGAGGG - Intergenic
1070972017 10:80575458-80575480 ATTTAGAAACAAAGGGATGTGGG + Intronic
1071131848 10:82403735-82403757 ATTTAGAAATAGAGGGACAATGG + Intronic
1071892650 10:90028436-90028458 ACTCAGGCACAGAGGGAGCAGGG - Intergenic
1072298927 10:94040332-94040354 ATTTAGGCAGAAAGGGAGGAGGG - Intronic
1073560208 10:104489775-104489797 TTGTTGACACAGAGGAAGGAGGG + Intergenic
1073745518 10:106464183-106464205 ATTTAAAGACAGAGTAAGGAGGG + Intergenic
1073909189 10:108321108-108321130 GTTAAGACACACAGGGAGGATGG - Intergenic
1074528893 10:114283271-114283293 AGTTAGACACACAGGCAGGCAGG + Intronic
1074763707 10:116685699-116685721 ATGTAGAAAGAGAGGGAGGGTGG + Intronic
1074876658 10:117618889-117618911 ACACAGACACAGAGGGAAGAAGG + Intergenic
1075275443 10:121088971-121088993 ATTGAGATGCAGAGGGTGGATGG + Intergenic
1075500921 10:122973408-122973430 ATTTATCCACAGAGGGAAAATGG - Intronic
1075900196 10:126036861-126036883 TTTTAGAAAGAGAGGAAGGAAGG - Intronic
1075944014 10:126416920-126416942 AGTGAGACACAGAGGGAAGAGGG + Intergenic
1076139706 10:128069291-128069313 AGTTTGACAGAGAGGGAGGCTGG + Intronic
1078332412 11:10436146-10436168 ATTGAAAGACAGAGGGAGCAGGG + Intronic
1079345692 11:19650269-19650291 ACATAGACACAGAGGGAAGGTGG + Intronic
1079805088 11:24921196-24921218 ATACAGAGACAGAGGGAGGGGGG + Intronic
1080275157 11:30495402-30495424 ATTTGGACACAGAGGGGAAACGG + Exonic
1081147272 11:39578430-39578452 ATTTGGTCACAGTGGGAAGAAGG - Intergenic
1082053851 11:47796501-47796523 ATTGAGAGAGAGAGGAAGGAAGG + Intronic
1082999870 11:59281430-59281452 ACTTAGTTCCAGAGGGAGGAAGG + Intergenic
1084122731 11:67078603-67078625 GTCTAGACACAGGGAGAGGATGG + Intergenic
1084415366 11:69029264-69029286 TTTAGGAAACAGAGGGAGGAGGG - Intergenic
1084596967 11:70122757-70122779 ACAGAGAGACAGAGGGAGGAAGG - Intronic
1084772764 11:71354623-71354645 ATTCAGAGACAGAAGGAGTATGG - Intergenic
1084919515 11:72457928-72457950 ATATAGAGATAGAGGAAGGAAGG + Intergenic
1085750472 11:79156592-79156614 ATCTAGACAGAGGGTGAGGAAGG - Intronic
1086092166 11:83015715-83015737 ATTTAGAGATTGAGGGAAGAAGG + Intronic
1086212304 11:84335247-84335269 ATGAAGGAACAGAGGGAGGAAGG + Intronic
1086226037 11:84510915-84510937 ATACAGGGACAGAGGGAGGAGGG + Intronic
1086293537 11:85338677-85338699 ATTTATACACAGAGGGTGTGTGG - Intronic
1086428896 11:86716316-86716338 GTTTATACAAAGAGGGAAGAGGG + Intergenic
1086429493 11:86721540-86721562 AAGTAGACTAAGAGGGAGGAGGG + Intergenic
1087141907 11:94772374-94772396 ATTTAGCAACAGAGTGAGGATGG - Intronic
1087341627 11:96914436-96914458 AATAAGTCACAGAGGGAGGGAGG - Intergenic
1089096493 11:115923958-115923980 ACTAAGACCCAGAGAGAGGAAGG + Intergenic
1089175812 11:116548002-116548024 AATTAGAGACAGAGGCAGGAGGG - Intergenic
1089330304 11:117684867-117684889 ATTGCTCCACAGAGGGAGGAAGG + Intronic
1091681848 12:2533043-2533065 ATTCGGGCAAAGAGGGAGGAGGG + Intronic
1092028090 12:5259807-5259829 AGTGAGTAACAGAGGGAGGAGGG + Intergenic
1092047214 12:5440376-5440398 ATCTAGAAACAGAGGGAAGGGGG - Intronic
1092629267 12:10361072-10361094 TTGTAGAGACAGAGGGAGGAGGG + Intergenic
1093213762 12:16338461-16338483 ATTAAGAAACAAAGGGAGGGTGG - Intergenic
1094128485 12:27049573-27049595 ACTGAGACACAGAGTGATGATGG - Intronic
1094683861 12:32691166-32691188 ATTTAGACACAGAGACACCACGG - Intronic
1095251824 12:39988468-39988490 ATTTAAAAAAAGAGGAAGGAAGG + Intronic
1098477499 12:70921659-70921681 ATAAAGACACAGAGGCAGAAAGG - Intergenic
1098800013 12:74944310-74944332 ATTTAGAGACAGAGGTAGTTGGG - Intergenic
1098814414 12:75139588-75139610 ATTTAGAGAAAGAGAGAGAAAGG - Intronic
1100406694 12:94278057-94278079 ATACAGAGACAGAGGGAGGGGGG - Exonic
1100473881 12:94917900-94917922 ATTGAGACACTGAGGCAGGAGGG + Intronic
1100784762 12:98067038-98067060 ATTAAGACACAGAGAAAGGGAGG + Intergenic
1100790604 12:98126089-98126111 ACATAGACACAGAAGGAAGAAGG - Intergenic
1102935416 12:116892330-116892352 ATATATACAAAGAGTGAGGAAGG + Intergenic
1102998664 12:117368510-117368532 GTTAAGGCCCAGAGGGAGGAGGG - Intronic
1104493641 12:129216443-129216465 AGACAGACACACAGGGAGGATGG + Intronic
1104498553 12:129263627-129263649 ATATAGAGAGGGAGGGAGGAAGG + Intronic
1104917000 12:132270859-132270881 ATTGCCACACACAGGGAGGAAGG + Intronic
1107392422 13:39980892-39980914 ATTTATACACAGTGGGAGAGAGG - Intergenic
1108859161 13:54832147-54832169 ATTGAGACAGAGAGGAAGAATGG + Intergenic
1110545608 13:76751951-76751973 TTTTGGATACAGAGGGAGGTAGG - Intergenic
1110917899 13:81046464-81046486 ACTAATACAAAGAGGGAGGATGG - Intergenic
1110952629 13:81515762-81515784 ATACAGAGAAAGAGGGAGGAGGG + Intergenic
1111336339 13:86829186-86829208 ATTTATACCCAGATGTAGGATGG + Intergenic
1111340753 13:86882516-86882538 ATACAGAGACAGAGGGAGGGGGG - Intergenic
1111586424 13:90289303-90289325 ATTTTGACACAGAGAAAGAAGGG + Intergenic
1111808971 13:93074063-93074085 ATTTTGACACAGATTCAGGAGGG - Intergenic
1112237668 13:97650917-97650939 ATACAGAGACAGAGGGAGGGGGG + Intergenic
1112369750 13:98784395-98784417 GTGAAGACACAGGGGGAGGATGG - Intergenic
1113159217 13:107360851-107360873 AATAAGAGAGAGAGGGAGGAGGG - Intronic
1113192405 13:107764457-107764479 ATGTAGACAGAGAGAGAGAAAGG + Intronic
1114690075 14:24573343-24573365 ATGTGGACACAGGGAGAGGATGG + Intergenic
1114767396 14:25389497-25389519 GTTAAGAGTCAGAGGGAGGAAGG - Intergenic
1115406347 14:33021336-33021358 ATTGAGACACAGAGGGCAGTTGG + Intronic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1116727317 14:48576575-48576597 ATTTATAGACAGTGGGTGGAAGG - Intergenic
1117410845 14:55449608-55449630 ACTGAGACACAGAGAGAAGAAGG + Intronic
1118016098 14:61662763-61662785 ACTTAGACACAGAGCAAAGAAGG - Intergenic
1118654090 14:67928367-67928389 ATACAGAGACAGAGGGAGGGGGG + Intronic
1120239543 14:81934111-81934133 AGAAAGACACAGAGGGAGGGGGG - Intergenic
1120499035 14:85271059-85271081 ATTTAGAGACAAAGAGAGTAAGG - Intergenic
1120669019 14:87342508-87342530 AGTTAGACATAGGGGGAAGATGG + Intergenic
1120984608 14:90323313-90323335 TATTACACATAGAGGGAGGAAGG + Intronic
1121115711 14:91341363-91341385 AGTCAGACTCAGGGGGAGGAGGG - Intronic
1121854470 14:97254204-97254226 AAGGAGACACAGAAGGAGGAAGG - Intergenic
1122011671 14:98754345-98754367 AAGTAGAAACAGAGGGTGGAAGG + Intergenic
1122093264 14:99353636-99353658 ATTTATACACAGAGGGCTTAAGG + Intergenic
1122097809 14:99384231-99384253 ATTCAGGCCCAGAGGGAGGCGGG + Intergenic
1122123708 14:99568086-99568108 CTTTAGGCAGAGAGGCAGGAGGG + Intronic
1124639638 15:31389498-31389520 ATGTAAACACAGGGGGAGGAGGG - Intronic
1124948991 15:34298745-34298767 ATATTGAGACTGAGGGAGGAAGG - Intronic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1126765148 15:52004149-52004171 TCTGAGTCACAGAGGGAGGAGGG + Intronic
1127512123 15:59653199-59653221 ATTTAGAAACAGATGAGGGATGG + Intronic
1128159700 15:65415507-65415529 ACGTAGACACAGAGAGAAGACGG + Intronic
1129229502 15:74188983-74189005 ATCGAGACCCAGAGAGAGGAAGG + Intronic
1129660921 15:77552486-77552508 ACTGAGGCACAGAGGGAGAAGGG - Intergenic
1130040708 15:80403953-80403975 ATTTAGATTCAGAGGGAAGCCGG - Intergenic
1130706323 15:86236701-86236723 ATACAGAGACAGAGGGAGGGGGG + Intronic
1130733451 15:86523327-86523349 ACTTGGACACAGAGGGAAGATGG - Intronic
1130763807 15:86849848-86849870 CTTTAGAAACAGAGTGAGTAAGG + Intronic
1131006923 15:88985995-88986017 ATACAGAGACAGAGGGAGGGGGG + Intergenic
1131148297 15:90030393-90030415 ACTGAGGCACAGAGGAAGGAGGG + Intronic
1131620077 15:94058909-94058931 TTTGAGACCCAGAGTGAGGAAGG - Intergenic
1131994919 15:98124531-98124553 ATTTAGAAACGGAGTGAGGAAGG - Intergenic
1133897481 16:9943319-9943341 TTTTAAACACAGAGCGAGGGAGG + Intronic
1134511362 16:14850338-14850360 TTCTAGAGAAAGAGGGAGGAGGG + Intronic
1134699006 16:16248835-16248857 TTCTAGAGAAAGAGGGAGGAGGG + Intronic
1134972831 16:18545838-18545860 TTCTAGAGAAAGAGGGAGGAGGG - Intronic
1135020369 16:18957872-18957894 ATTTAGTCACTGAAAGAGGATGG - Intergenic
1135821123 16:25687142-25687164 ATTTGGAGACAGGGGGAGGGTGG + Intergenic
1136083639 16:27869010-27869032 ACTAAGAGGCAGAGGGAGGAGGG + Intronic
1136147469 16:28323727-28323749 ATTTACAAACACATGGAGGAAGG - Exonic
1136376994 16:29871584-29871606 ATTTACACAGCCAGGGAGGAGGG + Exonic
1137065995 16:35843960-35843982 AGTTAGATACAGAGGGAGGGAGG + Intergenic
1138235005 16:55374687-55374709 ACTGACACACAGAGGGAGGAAGG + Intergenic
1138626511 16:58256206-58256228 GTTTAGAAAGAGAGAGAGGAGGG - Intronic
1138648362 16:58441858-58441880 ACTCAGGCACAGAGGGAGGTAGG + Intergenic
1139299876 16:65935781-65935803 GATTAGAGACAGAGGGAGAAGGG - Intergenic
1140169389 16:72587322-72587344 TTTTAGACATAGAGACAGGATGG + Intergenic
1140471411 16:75217387-75217409 AGTAAGACACAGTGGGTGGATGG - Intergenic
1140914668 16:79483088-79483110 AAGTAGGGACAGAGGGAGGAAGG - Intergenic
1141161081 16:81629545-81629567 AAGGAGACAGAGAGGGAGGAAGG - Intronic
1141188760 16:81808368-81808390 TTTTAGAGAGAGAGGGAGGAGGG + Intronic
1141526093 16:84612898-84612920 ACTGAGGCACAGAGGGAGGGAGG + Intronic
1142488645 17:263151-263173 ATCTAGACAAGGAGGGAGGTGGG + Intronic
1142593746 17:1019620-1019642 ATTTAAACACAGAGGAGGGAGGG + Intronic
1143542947 17:7580373-7580395 ATATAGGCTCAGAGGGAAGAAGG + Intronic
1144012371 17:11161845-11161867 ATACAGAGACAGAGGGAGGGGGG - Intergenic
1144353290 17:14420153-14420175 AGTTAAACCCAGAGGGGGGAAGG - Intergenic
1145991378 17:29081108-29081130 ATAAAGACACAGGGGGAGGGAGG + Intronic
1146459783 17:33036941-33036963 ATTTAGAATCGGAGGGAGAAGGG + Intronic
1146508458 17:33425624-33425646 ATTTGGACACAGAGAGATGGTGG + Intronic
1148427906 17:47616148-47616170 ACTGAGACCCAGAGGGATGAAGG + Intronic
1148685959 17:49501415-49501437 ATGAAGACTCAGAGGGAAGATGG + Intronic
1149144083 17:53468838-53468860 ATTTTAAGACAGAGGCAGGAGGG + Intergenic
1149230339 17:54526389-54526411 TTTTAGGCACAGAGGGTAGAAGG + Intergenic
1151470193 17:74313281-74313303 CTTTAGACCCAGGGGGAGGGAGG - Intronic
1152307587 17:79530331-79530353 ATTTATTCGCAGAGGGACGAGGG - Intergenic
1152366854 17:79861388-79861410 ACTTGGACAGAGAGGGAGGAAGG + Intergenic
1155196103 18:23476292-23476314 ATTAAAACACAGAGGGATAATGG - Intronic
1155291380 18:24345764-24345786 CTTTAGACAGTGAGTGAGGAAGG - Intronic
1155945150 18:31840364-31840386 ATAGAGAGACAGAGGGAGGGAGG + Intronic
1156254900 18:35385609-35385631 ACTCAGACACAGAGGGAAGAAGG - Intergenic
1157511174 18:48275987-48276009 CTCAAGATACAGAGGGAGGAGGG + Intronic
1157564346 18:48669563-48669585 GTTTAGGCAAAGAGGCAGGAGGG - Intronic
1158565755 18:58553009-58553031 ACAGAGACACAGAGGGAAGAAGG + Intronic
1158602379 18:58865629-58865651 ATTTAGACACAGACGGACCGTGG + Intronic
1158619398 18:59018778-59018800 ATATAGAAACAGAGGGAGAGTGG + Intergenic
1159259739 18:65998181-65998203 AGTTAGGCACAGAGGAAGGCAGG - Intergenic
1159274014 18:66192307-66192329 ATGAAGCCACAGATGGAGGAAGG - Intergenic
1160021380 18:75184319-75184341 ATTTACACAAGGAGGGAGGGGGG + Intergenic
1162153293 19:8660342-8660364 CTGTAGACACAGAGGGGGAATGG + Intergenic
1162172512 19:8802521-8802543 ATTCAGCCACAGAGGTGGGAAGG - Intergenic
1162234924 19:9301293-9301315 ACTTAGACACACAGGCAAGAAGG + Intronic
1163178541 19:15582993-15583015 ATTTAGGGTCAGAGGGAGGTTGG + Intergenic
1163276396 19:16287119-16287141 AGTCAGACACAGAGAGAGAAGGG - Intergenic
1163764644 19:19156032-19156054 ATGTAGACGCAGAGGCTGGATGG + Intronic
1163780049 19:19241503-19241525 ATTTTTACACAGCGGGAGAAGGG - Intronic
1165112460 19:33510344-33510366 ATATGGAGACAGAGGGAGGGGGG + Intronic
1165474613 19:36023354-36023376 ATGGAGACCCAGAGGCAGGAAGG - Intronic
1165854527 19:38871482-38871504 TTGTAGTCCCAGAGGGAGGAGGG - Intronic
1167386022 19:49164315-49164337 AGAGAGACAGAGAGGGAGGAAGG - Intronic
1167690240 19:50980594-50980616 ACAGAGACACAGAGAGAGGAGGG + Intronic
1167690281 19:50980762-50980784 ACAGAGACACAGAGAGAGGAGGG + Intronic
925166678 2:1719895-1719917 ATTCAGAGAGAGAGGGAGGGAGG + Intronic
925583008 2:5433200-5433222 ATATAGAGAGAGAGAGAGGAGGG + Intergenic
925790048 2:7475457-7475479 ACACACACACAGAGGGAGGATGG + Intergenic
925913703 2:8589560-8589582 ATAGAGAGAGAGAGGGAGGAGGG + Intergenic
926593958 2:14769876-14769898 AGTCAGACACACAGGGAGCAGGG - Intergenic
926821578 2:16857185-16857207 ATTTAGACACAGTGGGTACATGG + Intergenic
927204186 2:20596758-20596780 CTTCAGACACAGCAGGAGGAAGG - Intronic
927350362 2:22105503-22105525 ACAGAGACACAGAGGAAGGAAGG + Intergenic
927383949 2:22511422-22511444 ATACAGACACAGAGGGAAGTTGG - Intergenic
928031636 2:27784628-27784650 ATAAAGACACAGAAGGAGGAAGG + Intronic
928418135 2:31113799-31113821 ACTCAGGCACAGAGGGAGGTGGG + Intronic
929560924 2:42955873-42955895 ATGTAGACAAAGATGAAGGAGGG - Intergenic
930515264 2:52399755-52399777 AATTAGATCCAGAAGGAGGAAGG - Intergenic
930616341 2:53598568-53598590 AGAGAGACAGAGAGGGAGGAAGG + Intronic
931677302 2:64710006-64710028 ATTTAAAATCAGAGGGAGGCTGG - Intronic
932555956 2:72825441-72825463 AGTTAGAGACGGAGGGAGAAGGG + Intronic
932981388 2:76672571-76672593 ATTTAGACACAGAGACATGCAGG - Intergenic
933261382 2:80135354-80135376 ATCTAGAGACAAAGGAAGGAGGG + Intronic
933783860 2:85822563-85822585 ATGTGGAGAGAGAGGGAGGAAGG - Intergenic
934147038 2:89105058-89105080 ACACAGAGACAGAGGGAGGAGGG - Intergenic
934222228 2:90095537-90095559 ACACAGAGACAGAGGGAGGAGGG + Intergenic
934684021 2:96307164-96307186 ATTTAATCACAATGGGAGGAAGG - Intergenic
935265754 2:101392453-101392475 AATGACACACAGAAGGAGGAAGG + Intergenic
935380453 2:102446459-102446481 CTTTAGAGACTGAGGGAGAAGGG - Intronic
936888480 2:117341180-117341202 AGAGACACACAGAGGGAGGAAGG - Intergenic
936949784 2:117966298-117966320 TTTTATACACTGATGGAGGAAGG + Intronic
937025980 2:118697363-118697385 AGTGAGGCACAGGGGGAGGAAGG + Intergenic
937258650 2:120571755-120571777 AGTTAGAGATAGAGGCAGGAGGG - Intergenic
937727163 2:125180878-125180900 ATGCACACACAGAGAGAGGAAGG - Intergenic
937752734 2:125497474-125497496 GTACAGAGACAGAGGGAGGAGGG - Intergenic
938782020 2:134593204-134593226 ATTTAGACAGGGAGGGAAGGGGG + Intronic
939637260 2:144597493-144597515 ATGTAGACAGGGAGGCAGGATGG + Intergenic
939865450 2:147467443-147467465 ATTTGGACACAGAGACAGGAAGG - Intergenic
940032152 2:149274868-149274890 AATTAGACGCAGAGAGAGGAAGG + Intergenic
940121121 2:150267372-150267394 AATGAGACAGAGAGGGAGGAAGG - Intergenic
940545974 2:155085858-155085880 ATGCAGACTCAGAAGGAGGAGGG + Intergenic
940733879 2:157427131-157427153 ATAGACACACAGAAGGAGGAAGG + Intronic
941218021 2:162738286-162738308 AGTTATACACAGAGGGAGTAGGG - Intronic
941418435 2:165251626-165251648 AATTAGAATCAGAGGGAGTAGGG - Intronic
941981612 2:171464451-171464473 TTGAAGACACAGAGGGAGAAAGG - Intronic
942890729 2:180983689-180983711 AATGAGACAAAAAGGGAGGAGGG - Intronic
943953761 2:194160900-194160922 ATTTTGACACAGAGAAAGAAGGG - Intergenic
944015011 2:195025747-195025769 ACATAGACACACAGGGAAGAAGG + Intergenic
945176465 2:207048492-207048514 ATTTAGACATGGAAGGAGAAAGG - Intergenic
945200430 2:207275609-207275631 AATTATACACAGTGGAAGGAAGG - Intergenic
946063414 2:216965746-216965768 AATCAGAGACAGAGAGAGGAAGG + Intergenic
946307006 2:218861724-218861746 ATTTAGACAGAGGGGGAGGGAGG - Intronic
946396131 2:219444600-219444622 AGTTGGAGGCAGAGGGAGGAGGG + Intronic
946580082 2:221119011-221119033 ATGTAGAGAAAGAGGGAGGGTGG - Intergenic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
947029942 2:225782598-225782620 AGGGAGAAACAGAGGGAGGAAGG - Intergenic
948351610 2:237345594-237345616 CTTTAGACACGGAGGGAGCCAGG - Intronic
948997077 2:241586738-241586760 AATTAGACACAGATGAAGAAAGG + Intronic
1168826785 20:819398-819420 AAAGAGACAGAGAGGGAGGAAGG - Intergenic
1169319152 20:4616951-4616973 ACACAGACACAGAGGGAAGATGG - Intergenic
1169502911 20:6178177-6178199 ACAGAGACACAGAAGGAGGATGG + Intergenic
1169759396 20:9074862-9074884 ATTTAGACCTGGAGGGAGAAAGG + Intronic
1169780726 20:9307082-9307104 AGTTCCACACAGAAGGAGGAGGG + Intronic
1169990249 20:11495270-11495292 GGTGAGAGACAGAGGGAGGAAGG + Intergenic
1171114612 20:22513838-22513860 ATTTAGACCCAGATGGACAACGG - Intergenic
1171980883 20:31627925-31627947 AAGTAGACATAGAGGGAAGATGG + Intergenic
1172033127 20:31995469-31995491 ACTTATACTCAGAGTGAGGAGGG + Intronic
1172112609 20:32556173-32556195 ATAGAGACACAGAGGGAGGCAGG - Intronic
1172511118 20:35501757-35501779 ATATAGAGGCAGATGGAGGATGG - Intronic
1173152768 20:40581962-40581984 GTTTGGACACAGTGGGAGTATGG - Intergenic
1173364163 20:42370019-42370041 ACCTGGACACAGAGAGAGGAGGG - Intronic
1173869958 20:46335136-46335158 ATTAAAACACAGAGGAGGGAAGG - Intergenic
1174790031 20:53469607-53469629 AGATAGATAGAGAGGGAGGAAGG + Intronic
1175740575 20:61417274-61417296 AGAAAGACAGAGAGGGAGGAGGG - Intronic
1176105501 20:63384023-63384045 GTTTGGACACTGGGGGAGGACGG - Intergenic
1176668484 21:9709608-9709630 ATCAAGACGCAGAGGAAGGAAGG + Intergenic
1177508470 21:22050203-22050225 ATTTAGACAAGGAGGAAGTAAGG + Intergenic
1179540860 21:42082606-42082628 AGGAGGACACAGAGGGAGGAGGG - Intronic
1179560268 21:42211461-42211483 AGGTAGAGACAGAGAGAGGAAGG - Intronic
1181042951 22:20201465-20201487 GTTTAGGCAGAAAGGGAGGAAGG - Intergenic
1181116119 22:20633379-20633401 AGTTGGGCAGAGAGGGAGGAGGG - Intergenic
1181313575 22:21958287-21958309 ATTCTGACACAGAGAGAGGGTGG + Intronic
1181346683 22:22224359-22224381 ATTCTGACACAGAGAGAGGGTGG + Intergenic
1181438428 22:22923436-22923458 AGCTGGGCACAGAGGGAGGAGGG - Intergenic
1181841913 22:25670626-25670648 ATTCAGGGAGAGAGGGAGGAAGG - Intronic
1182275891 22:29188391-29188413 GTTAAGACACAGAGAGAAGATGG - Intergenic
1182345868 22:29664314-29664336 GTTTAGCCTGAGAGGGAGGAAGG - Intronic
1182414360 22:30211536-30211558 ATATAGGCCCTGAGGGAGGAAGG + Intergenic
1183074639 22:35419232-35419254 ACTGAGACCCAGAGGGAGGGAGG - Intronic
1183090742 22:35520206-35520228 ATTGAGACACAGGGGAAGAAGGG + Intergenic
1183109443 22:35638199-35638221 ACAGAGACACACAGGGAGGAGGG - Intergenic
1183548363 22:38467482-38467504 ATTGAGACCAAGAGAGAGGAAGG + Intergenic
1183805244 22:40203848-40203870 TGTTAGTCAGAGAGGGAGGAGGG + Intronic
1184111657 22:42399066-42399088 ATTTAGCAAAAGAGGGAGGAGGG + Intronic
1185061598 22:48609889-48609911 GTTAGGACACAGAGGGAGGACGG - Intronic
1185163914 22:49246073-49246095 GTTCAGAGACAGAGAGAGGATGG + Intergenic
949327212 3:2880202-2880224 ATTTATAGACAGAGAGAGGCTGG + Intronic
949508016 3:4744873-4744895 AGGGAGACAGAGAGGGAGGAAGG - Intronic
949875405 3:8623351-8623373 AGTAAGACGCAGAGGCAGGAAGG - Intronic
950233569 3:11297696-11297718 ATTTAGGCACTGTGGGAGGTGGG + Intronic
950350001 3:12340494-12340516 ATTGAAACACAGAGGGAAGGAGG - Intronic
950451623 3:13068663-13068685 ATTGGGCCACAGAGGGAGGATGG - Intronic
951245613 3:20338097-20338119 ATTTACAAACTGAGGGAAGAGGG + Intergenic
951932645 3:27985921-27985943 ATGAAGACACAGAGAGAAGATGG + Intergenic
952033243 3:29170116-29170138 ATTTAGAAAGAGAGGAAGGAAGG + Intergenic
952849144 3:37713475-37713497 ATTGAGCCACAGAGGGAGGAGGG + Intronic
953120571 3:40037380-40037402 ATTTAGGAATAGAGGGAGGCAGG + Intronic
953391780 3:42538086-42538108 GTTTAGACACAGAGGCAGTATGG + Intergenic
954235274 3:49252270-49252292 ATTTACACACTGAGGGAGTGAGG + Intronic
954857870 3:53662293-53662315 ATTAAGAGACTGAGGGAGAATGG + Intronic
956791064 3:72680479-72680501 ATGTACTCACAGTGGGAGGATGG - Intergenic
957274111 3:78068206-78068228 ATACAGAGACAGAGAGAGGAGGG + Intergenic
957411978 3:79853104-79853126 ATTTAGAAACAGAGAATGGAAGG - Intergenic
959204776 3:103292458-103292480 ATTCAGAGACAGATGGGGGAAGG + Intergenic
960617137 3:119606311-119606333 ATTTGGACACAGACAGAGGGAGG - Intronic
961542547 3:127609807-127609829 ACTGAGAAACAGAGGAAGGAAGG - Intronic
962405694 3:135097959-135097981 AAGTTGGCACAGAGGGAGGATGG - Intronic
962751325 3:138436327-138436349 ATTAGGACACAGAAGGAAGACGG - Intronic
963097999 3:141566038-141566060 ATTTAAAAATAGAAGGAGGAAGG - Intronic
963473703 3:145776584-145776606 AGATAGAGAAAGAGGGAGGAAGG - Intergenic
964016085 3:151948445-151948467 ATTTTGAAACTGAGGGAAGAAGG + Intergenic
964630048 3:158800793-158800815 ATTTAGAGAGAGAAGGAGGTAGG - Intronic
964975032 3:162607580-162607602 GTTAAAACACAGAGGGAAGAAGG - Intergenic
965095272 3:164217544-164217566 ACTTACACACAGTGGGAGGATGG + Intergenic
965099398 3:164277427-164277449 ATACAGAGACAGAAGGAGGAGGG + Intergenic
965130982 3:164701230-164701252 ATTTAGAAAGAGGGGGAAGAGGG + Intergenic
965819072 3:172666479-172666501 ATACAGAGACAGAGGGAGGGGGG - Intronic
967393408 3:188979742-188979764 ATTCATAATCAGAGGGAGGAGGG - Intronic
969173291 4:5380849-5380871 ATTGAGACTCAGAGGAGGGAAGG + Intronic
969327848 4:6454003-6454025 ATTTAAACACAGAGGAAAGGAGG - Intronic
970410291 4:15799868-15799890 GCTCAGGCACAGAGGGAGGAGGG + Intronic
970778936 4:19712160-19712182 ATTTTGATACAAAGGGAGGAAGG - Intergenic
970965276 4:21921282-21921304 ATTTAGAGATAGAGCAAGGAAGG - Intronic
971138404 4:23896630-23896652 ATTGAGAAACAAAGGGAAGATGG - Intronic
971138901 4:23901681-23901703 AAATACACACAGAGGGAAGAAGG + Intronic
971552423 4:27974600-27974622 GTTAAATCACAGAGGGAGGAAGG - Intergenic
971738891 4:30495450-30495472 ATTCAGACACAGAAGGATTAAGG + Intergenic
971797337 4:31244604-31244626 ATGTAGACAAAGGGGGAGGTGGG + Intergenic
973251950 4:48069750-48069772 ACTGAGACATAGAAGGAGGAAGG - Intronic
973831971 4:54770700-54770722 ATTTTGAGACAGAGAGAGAAAGG + Intergenic
974343170 4:60640263-60640285 ACATAGACACAGAGAGAAGAAGG - Intergenic
974347669 4:60702607-60702629 ATGTAGACTAATAGGGAGGAAGG + Intergenic
977200239 4:94106697-94106719 ACAGAGACACAGAGGGAAGATGG - Intergenic
978627352 4:110702424-110702446 AATTAGACACACAGAGCGGAAGG + Intergenic
979374086 4:119924054-119924076 ATTTTGAAACAGATAGAGGAGGG - Intergenic
979474020 4:121133811-121133833 ATTTGGACACAGATGGAAGATGG + Intronic
979729262 4:124003941-124003963 ATTTTTGAACAGAGGGAGGAAGG + Intergenic
980515330 4:133850678-133850700 ATTTAGACCCAGAGAGAGAAAGG + Intergenic
980848136 4:138348774-138348796 TTAGAGACACAGAAGGAGGAAGG + Intergenic
981050566 4:140305666-140305688 ATATAGACAGAGAGGAAGGTAGG + Intronic
981477205 4:145198926-145198948 ACTTAGCCAGAGAAGGAGGAGGG - Intergenic
982743959 4:159087006-159087028 CTTGAGAGACAGAGGCAGGAGGG + Intergenic
983842337 4:172472679-172472701 ACTCAGACACAGAGGGAAGGTGG + Intronic
983868169 4:172792845-172792867 ATATAGATAAAGAGGGAGGAAGG - Intronic
984736478 4:183113268-183113290 ATGTAGAAACAGAGGGAGGAGGG + Intronic
984856995 4:184204061-184204083 ATATAGACACAGGGGGAAGGCGG - Intronic
984883853 4:184432731-184432753 ACACAGACACAGAGGGAGGATGG + Intronic
984941545 4:184936471-184936493 ATACAGAGACAGAGGGAGGGGGG - Intergenic
985009309 4:185566327-185566349 ATACAGAGACAGAGGGAGGGGGG + Intergenic
985406295 4:189641900-189641922 ATCAAGACGCAGAGGAAGGAAGG - Intergenic
985763375 5:1763365-1763387 CTCTAGACACAGAGGGTGGCCGG + Intergenic
985800338 5:2001677-2001699 AGATAGGCACAGAGGGATGAAGG - Intergenic
985882842 5:2653568-2653590 GGTTAGACACAGAAGGAGCATGG - Intergenic
985884313 5:2664796-2664818 TTTGAGATAGAGAGGGAGGAAGG + Intergenic
986076551 5:4343885-4343907 ATGAACACACAGAGGGAAGAAGG + Intergenic
986108155 5:4680770-4680792 ATTAAAATACAGAGGGATGAAGG + Intergenic
986157413 5:5190521-5190543 ATTGAGATACAGAGAGAGAAGGG - Intronic
986398134 5:7351070-7351092 ATTGAGAGAAGGAGGGAGGAGGG - Intergenic
986509300 5:8486540-8486562 CTTTAGACACTCTGGGAGGAAGG + Intergenic
987160327 5:15134823-15134845 ATTTAGACCCACTGGGAGGCAGG - Intergenic
987667808 5:20967226-20967248 TTTTAAACACACAGGGAAGAAGG - Intergenic
988785315 5:34561389-34561411 TCTTAGATCCAGAGGGAGGAAGG - Intergenic
989807666 5:45630243-45630265 ATTTAAGCAGAGAGGGAGCAAGG + Intronic
990171050 5:53050117-53050139 ATTTAGAAACAGAGGAAATAAGG - Intronic
990317858 5:54601077-54601099 ATGGACAGACAGAGGGAGGACGG - Intergenic
990803255 5:59629436-59629458 ATTTGGACACAGAGACATGAAGG + Intronic
991063706 5:62403983-62404005 TTGGAGTCACAGAGGGAGGAAGG + Intronic
991559740 5:67937231-67937253 ATTTAGAGACAGAAGGCAGATGG + Intergenic
993005697 5:82425979-82426001 ATTTATACACAGAAGGATTAAGG - Intergenic
993592197 5:89808050-89808072 CATGAGACATAGAGGGAGGAGGG - Intergenic
994065186 5:95531818-95531840 ATTTAGCCACAGAGGCAATAAGG - Intronic
994089992 5:95801256-95801278 GTACAGACACAGAGGGAGGGCGG - Intronic
995469968 5:112490955-112490977 ATAGAGACACAGAGGGAGGAAGG + Intergenic
996213857 5:120843760-120843782 ATTTAGTGACTGAGGGAGGTAGG + Intergenic
997716170 5:136044563-136044585 GTTTAGACACAGAGGGAGATGGG - Intronic
998162742 5:139822621-139822643 CCTTGGACACAGAGGGAGGCCGG - Intronic
998484715 5:142491562-142491584 TATTAGAGAGAGAGGGAGGAAGG + Intergenic
998824059 5:146083332-146083354 ATAGAGACACAGAGGGAAGACGG - Intergenic
999355881 5:150930139-150930161 ATTTAGACAAACAAGGGGGAGGG - Intergenic
999501655 5:152152552-152152574 ACTGAAACACAGAGAGAGGAAGG - Intergenic
999797406 5:155001467-155001489 ATAGAGACACAGAGGGAAGATGG + Intergenic
999800023 5:155024917-155024939 ATCTGGACACAGAGAGAGGTAGG - Intergenic
999962910 5:156776182-156776204 ATTTAAACACTGAGTGGGGATGG - Intergenic
1000399194 5:160807615-160807637 ATTGAGAAACTGATGGAGGAAGG + Intronic
1000831982 5:166113583-166113605 ACTTAGAAACAGAAGGATGAAGG + Intergenic
1001993304 5:176134572-176134594 ATCTAGGCACAGAGGGATGGAGG + Intergenic
1003357458 6:5387009-5387031 ATTTAGTGACAGTGGAAGGAAGG + Intronic
1003542878 6:7033488-7033510 ATTTAGAGATGGAGAGAGGAGGG - Intergenic
1003652676 6:7975819-7975841 ATGTAGACAGAGAAGCAGGATGG + Intronic
1003673776 6:8183708-8183730 ACTTAGAGGCAGAGGGAAGATGG + Intergenic
1003939760 6:11012648-11012670 ATTTAGTCACAGTGGAAGAAGGG + Intronic
1005047226 6:21653867-21653889 ATACAGAGACAGAGGGAGGGGGG + Intergenic
1005423882 6:25680880-25680902 ATTTGGAGACAGAGGAAGGATGG + Intronic
1005995400 6:30927956-30927978 ATTTCCACCCAGAGGGAGGAGGG + Intergenic
1006301754 6:33197323-33197345 ATGGAGACACAGAAGAAGGAAGG + Intronic
1007493223 6:42240576-42240598 GTTGAGACCCAGAGAGAGGAAGG - Intronic
1007577377 6:42934461-42934483 ATTTACACACTGGGGGAGGGAGG - Exonic
1008083750 6:47221945-47221967 GTATAGAGACAGAGGGAGGGGGG - Intergenic
1008639112 6:53443408-53443430 ATTAAGACACAGATTGAGGCTGG + Intergenic
1008883348 6:56405032-56405054 ATTTACACATAGAGGGAGTAGGG + Intergenic
1009291324 6:61886382-61886404 ATTTAGAAGCAGAGAGAAGAGGG - Intronic
1009497328 6:64367490-64367512 TTTTGGAAAGAGAGGGAGGATGG + Intronic
1009660862 6:66609392-66609414 ATTTTGAAACAGAGGAAGCAAGG - Intergenic
1010452037 6:76014331-76014353 TTTGAAACTCAGAGGGAGGAAGG + Intronic
1010756443 6:79671054-79671076 ATTTAGAAAGAGAGGGAGATTGG + Intronic
1011608701 6:89129568-89129590 AATTAGAAACAGAGAGAAGAGGG - Intergenic
1013168450 6:107615225-107615247 ACATAAACACAGAGGAAGGAAGG + Intronic
1013491651 6:110652747-110652769 ATGAAGACACAGAGAGAGAAAGG + Intronic
1013964002 6:115934073-115934095 ATTTAGAGAGAGAGAAAGGAGGG + Exonic
1013991194 6:116255563-116255585 ATTAAGACAAAGAGGAAAGAGGG - Intronic
1015734925 6:136388934-136388956 ATTTAGACTCAGAGTGGGTAAGG - Intronic
1016379174 6:143456176-143456198 ATTTAGACACAGAGGGAGGAAGG + Intronic
1016612302 6:146004546-146004568 ATTTTGAAAAATAGGGAGGAAGG + Intergenic
1016943918 6:149510290-149510312 AGTTACCCACAGAGGGAAGAAGG + Intronic
1018190871 6:161308143-161308165 GTTCAGAGACAGAGGGAGGTGGG + Intergenic
1018501808 6:164419313-164419335 ATATTGACTCAGAGGGAGGTAGG + Intergenic
1018846573 6:167561027-167561049 ACTGAGGCACAGAGGGAGGAAGG - Intergenic
1018961929 6:168455382-168455404 ATTTAGAGAGAGGGGCAGGAAGG + Intronic
1020851926 7:13364380-13364402 ATAAAGACACAGAGGGAGGGGGG - Intergenic
1021027007 7:15681659-15681681 TTTGAAACACAGAGGGAGAATGG + Intronic
1021176985 7:17460634-17460656 ATACAGAGACAGAGGGAGGGAGG + Intergenic
1021191274 7:17622350-17622372 AGATAGACACAGAGTGAGGTAGG + Intergenic
1021280259 7:18708282-18708304 ATGGAGAAAAAGAGGGAGGAAGG + Intronic
1021309884 7:19080733-19080755 ATTCAGACCCAAAGAGAGGAAGG - Intronic
1021345271 7:19519714-19519736 ATTGAGACACAGAGGAAGAAAGG + Intergenic
1022355804 7:29613345-29613367 ATTTGGATACAAAGGGAAGAAGG + Intergenic
1022845744 7:34207998-34208020 TTTAAGAAACAGAGGGAAGATGG + Intergenic
1023113122 7:36834267-36834289 AGTCACACACAGAGGGAGGGTGG + Intergenic
1023247392 7:38219726-38219748 ATTGAGAAACAGAGGGGGTAGGG - Intronic
1024979613 7:55146352-55146374 ATTTAGAAATATGGGGAGGAAGG - Intronic
1025048566 7:55714300-55714322 AGTTAAACACAGAGGCAGCATGG + Intergenic
1025603808 7:63024439-63024461 ATTTAGACATTGCAGGAGGAGGG - Intergenic
1026128912 7:67604424-67604446 ATTTAAAGTCTGAGGGAGGAGGG + Intergenic
1026289083 7:68989791-68989813 ATGGAGACACAGATGGAAGAAGG - Intergenic
1027804638 7:82801581-82801603 ATTTCTAAACAGAGGGAAGATGG - Exonic
1028109462 7:86921390-86921412 ACACAGACCCAGAGGGAGGACGG + Intronic
1028396104 7:90369994-90370016 TTGGAGACTCAGAGGGAGGAAGG + Intronic
1028843038 7:95449529-95449551 TTTTAGGGACACAGGGAGGAAGG - Intergenic
1029961828 7:104695872-104695894 ATTTAGAAAATGAGGGAGCAAGG - Intronic
1030412418 7:109198134-109198156 ATGCAGACACAGAGGCCGGAGGG + Intergenic
1030996889 7:116370530-116370552 ACACAGACACACAGGGAGGAAGG + Intronic
1031075493 7:117208474-117208496 TATCAGACCCAGAGGGAGGAAGG + Intronic
1031087688 7:117320033-117320055 ATTTAGACACAGAGGCACCAAGG + Intronic
1031807492 7:126326185-126326207 ATTTAGAGAGAGAGAGAGGTAGG - Intergenic
1032339110 7:131054516-131054538 ATTTAGGAAGGGAGGGAGGAGGG + Intergenic
1032750041 7:134830286-134830308 ATTTGGACACACACAGAGGAAGG - Intronic
1033297156 7:140150566-140150588 ATTTACAAACATAGGGATGAGGG - Intronic
1033593569 7:142836460-142836482 ATATAGACACAGTGGGAGTGGGG + Intergenic
1034020824 7:147640767-147640789 ATACAGAGACAGAGAGAGGAAGG + Intronic
1034150611 7:148912249-148912271 ATTTGGACACAGGGAGAAGACGG - Intergenic
1034399485 7:150852653-150852675 AACAGGACACAGAGGGAGGAGGG + Intronic
1035255371 7:157622512-157622534 AAAGAGACACAGAGGGAGGGAGG + Intronic
1035543859 8:463748-463770 ATTTAGACACACAGTCTGGATGG - Intronic
1035705827 8:1673857-1673879 ATTTGGAGACAGAGGAAGGAAGG + Intronic
1035921212 8:3678033-3678055 ATTTAAAGACAGTGGGAGGGTGG + Intronic
1036149230 8:6282706-6282728 ATGTAGAGACATAGGGAGAAAGG + Intergenic
1037623080 8:20584109-20584131 ATTCAGATACTGAGGGTGGAGGG + Intergenic
1038054054 8:23841420-23841442 ATTTAGAAAGAGTTGGAGGAGGG - Intergenic
1038067558 8:23978895-23978917 ACTTATACACAGAGGGAAGGAGG - Intergenic
1039586041 8:38707930-38707952 ATTTTTACACAGAAGGCGGAGGG - Intergenic
1042025064 8:64414589-64414611 ATTGGGAGACAGAGGGAGAAGGG - Intergenic
1042040831 8:64586914-64586936 CTTTAGACACAGTAGGTGGAAGG + Intergenic
1043098979 8:76015689-76015711 ATTTACAAACAGAGCGATGATGG + Intergenic
1043620509 8:82186285-82186307 ATTTAAACACTGAGTGGGGAGGG + Intergenic
1045054901 8:98360381-98360403 ATGGAGACACAGAGGGAAGAAGG - Intergenic
1045372255 8:101536031-101536053 ATTTAGACAGAGAAGCAGGAAGG + Intronic
1046010413 8:108539591-108539613 ACACAGACACAGAGGGAAGATGG + Intergenic
1046552423 8:115733444-115733466 ATTTATATACAGAGAGAGAAGGG - Intronic
1046961126 8:120114074-120114096 ATACAGTCACAGAGGGAGCAGGG + Intronic
1047004718 8:120608498-120608520 ATGAAGACACAGAGAGAAGACGG + Intronic
1047207935 8:122818484-122818506 AACTAGGCAGAGAGGGAGGAGGG - Intronic
1048253167 8:132884055-132884077 AGACAGACACAGAGGGAAGATGG - Intronic
1049174713 8:141184778-141184800 AGGTGGACACAGAGGGAGGGAGG - Intronic
1049984033 9:931670-931692 AGATAGACACAGAGAGAGAATGG + Intronic
1050301132 9:4260010-4260032 ATGGAAACACAGAGGGAGAAAGG + Intronic
1050584172 9:7092902-7092924 ATTAAGAAATAGAGGGAGAATGG + Intergenic
1051909695 9:22139134-22139156 ATTTGAACACAGTGGGAAGATGG + Intergenic
1052593327 9:30527286-30527308 AGTTAGACAAAGAGGAAGCATGG + Intergenic
1055431999 9:76253416-76253438 ATTTAGACAATGAGGGGGCAGGG - Intronic
1055432639 9:76259433-76259455 GTGTAGACAGAGAGGGAGGGAGG - Intronic
1055554996 9:77464925-77464947 ACACAGACACAGAGGGAAGATGG + Intronic
1055710450 9:79055131-79055153 AGATAGACACTGAGGGAAGATGG + Intergenic
1056109654 9:83382482-83382504 ATTGAGACACAGAGGGTGTAAGG + Intronic
1056545054 9:87606478-87606500 AGGGAGAGACAGAGGGAGGAAGG - Intronic
1056643793 9:88392635-88392657 AGGTAGAAAAAGAGGGAGGAAGG - Intronic
1056702914 9:88925683-88925705 TTTGGGACACAGATGGAGGAAGG - Intergenic
1056728557 9:89143621-89143643 AGTTAGAGACAGAGGGATGGGGG + Intronic
1058937526 9:109782802-109782824 ATTAAGAGACAGAGGGAGTTGGG + Intronic
1059117909 9:111615978-111616000 ACATAGACACACAGGGAGGTGGG + Intergenic
1059388528 9:113984209-113984231 ATTAGGACACAATGGGAGGATGG + Intronic
1059904190 9:118963651-118963673 ATTTTGACAGACAGGGAAGAAGG - Intergenic
1060243104 9:121921707-121921729 AGTTAGACAAAGAGGGAGCAGGG + Intronic
1060401622 9:123353071-123353093 ACTCAGACACAGAGGGAGCAGGG + Intergenic
1061156189 9:128863197-128863219 AAGTAGACACACAAGGAGGAGGG + Intronic
1061798756 9:133103101-133103123 ATTTGGACACAGAGAGAAGGGGG - Intronic
1061906680 9:133702713-133702735 ATCTCGGCACAGAGGGAGGAGGG + Intronic
1203657382 Un_KI270753v1:11337-11359 ATCAAGACGCAGAGGAAGGAAGG - Intergenic
1185683840 X:1910789-1910811 AGAGAGACAGAGAGGGAGGAAGG - Intergenic
1186014314 X:5173921-5173943 TATTTAACACAGAGGGAGGAAGG + Intergenic
1186504315 X:10078504-10078526 ATATAGACACAGCGGGGGTACGG - Intronic
1187283534 X:17881315-17881337 ATACAGAGACAGAGGGAGGGGGG + Intergenic
1187602906 X:20851650-20851672 AAACAGACACACAGGGAGGAAGG + Intergenic
1188009536 X:25041592-25041614 ATGGAGACACAGAGAGAGGATGG - Intergenic
1188303982 X:28539840-28539862 ATGCAGACACAGAAGGAAGATGG + Intergenic
1188932235 X:36125870-36125892 ATGATGACACTGAGGGAGGAAGG - Intronic
1189511466 X:41666428-41666450 AGAGAGAGACAGAGGGAGGAAGG - Intronic
1189571038 X:42297299-42297321 ATATAGACACACAGGGGGAAAGG - Intergenic
1189985409 X:46549172-46549194 CTTGAGACACAGAGGGAAAAAGG - Intergenic
1190538813 X:51456616-51456638 ATACAGAGACAGAGGGAGGGGGG - Intergenic
1191882648 X:65857989-65858011 AGGAAGACAGAGAGGGAGGAAGG - Intergenic
1191936197 X:66429621-66429643 ATACAGAGACAGAGGGAGGGGGG + Intergenic
1192511427 X:71722654-71722676 AGGGAGACACAGAGGGAGTATGG - Intergenic
1192515270 X:71758851-71758873 AGGGAGACACAGAGGGAGTATGG + Intergenic
1192534687 X:71917307-71917329 TTTTAGAAAGAGAGGGAGGGAGG - Intergenic
1193057762 X:77172790-77172812 ATTTGGAAACAGTGGGAGGCAGG + Intergenic
1194222546 X:91213611-91213633 ATATAGAGACAGAGGAAGGAGGG + Intergenic
1194891521 X:99384919-99384941 ACTTTGGCACAGAGGGAGGCTGG - Intergenic
1196724914 X:118887172-118887194 ATTTTGACACAGAGGAAGAAGGG + Intergenic
1197160781 X:123319706-123319728 ATAAAGACACAGAGGCAAGAAGG - Intronic
1197163145 X:123345887-123345909 ATTTCTACAGAGAGGGATGAAGG + Intronic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1199018648 X:142848787-142848809 ATACAGAGACAGAGGGAGGGGGG - Intergenic
1200419717 Y:2951800-2951822 ATATAAACAAAGAGGTAGGAGGG + Intronic
1200559074 Y:4677376-4677398 ATATAGAGACAGAAGAAGGAGGG + Intergenic
1201461533 Y:14230782-14230804 AGGGAGACAGAGAGGGAGGAAGG + Intergenic
1201504709 Y:14685422-14685444 ATTGAGAGTCAGAGAGAGGAAGG - Intronic
1201696201 Y:16829142-16829164 ATTGAGGGACAGAGGAAGGAAGG + Intergenic
1201765409 Y:17569837-17569859 ATCCAGACAAAGACGGAGGAAGG + Intergenic
1201836143 Y:18336152-18336174 ATCCAGACAAAGACGGAGGAAGG - Intergenic
1201900461 Y:19042783-19042805 TTACAGAGACAGAGGGAGGAGGG - Intergenic
1202048069 Y:20753994-20754016 GTACAGACACAGAGGGAGGGAGG + Intergenic