ID: 1016382778

View in Genome Browser
Species Human (GRCh38)
Location 6:143501967-143501989
Sequence CTATTTATGAAACCCATACC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 112}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016382778_1016382779 1 Left 1016382778 6:143501967-143501989 CCAGGTATGGGTTTCATAAATAG 0: 1
1: 0
2: 0
3: 10
4: 112
Right 1016382779 6:143501991-143502013 TTCTCCATTGACTTTTAGCCAGG 0: 1
1: 0
2: 0
3: 17
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016382778 Original CRISPR CTATTTATGAAACCCATACC TGG (reversed) Exonic
902140813 1:14352512-14352534 CTACTAATAAAACCCATACTTGG + Intergenic
902566392 1:17314407-17314429 CCATTTATGATACACCTACCTGG - Intronic
906035814 1:42749850-42749872 CTATGTATGAAACCCTAACCCGG + Intronic
907717578 1:56941672-56941694 CAAATTATGAAACACGTACCTGG + Intronic
909779758 1:79528581-79528603 CTATTCAGGAAACCCTTCCCTGG - Intergenic
912118701 1:106440547-106440569 CTAATTATGATCCCCATAGCAGG - Intergenic
912858901 1:113195573-113195595 CTGTTTATAAAGCCCAGACCTGG - Intergenic
917826855 1:178831227-178831249 CCATTTAACAAAGCCATACCAGG + Intronic
918382219 1:183967565-183967587 CATTGTATGAAACCAATACCTGG - Intronic
918607441 1:186445291-186445313 ATGTTTATGAAAAACATACCAGG + Intronic
919982917 1:202653536-202653558 CTATTTCTGACCCCCATACGAGG - Intronic
920460256 1:206134230-206134252 CTAGTTATAAATTCCATACCAGG + Intergenic
920664358 1:207950456-207950478 CAATTTATAGAACCAATACCAGG + Intergenic
921805590 1:219450654-219450676 CTATTTATGACACCTAAAACAGG - Intergenic
923515207 1:234691907-234691929 GTATTTAGCAATCCCATACCTGG - Intergenic
924454248 1:244205647-244205669 CTGTTTATGAAATCTATACTGGG + Intergenic
1062766083 10:66346-66368 GTAATTATGAAAACCATTCCAGG + Intergenic
1063741260 10:8822774-8822796 CTATTTTTGGATGCCATACCTGG + Intergenic
1077010208 11:376247-376269 GTATTTATAGAACCCAAACCTGG - Exonic
1078729035 11:13959345-13959367 ATATTTATGGAACCCCTACCAGG + Intergenic
1080177160 11:29378989-29379011 ATATTTATGGAACACATAGCAGG - Intergenic
1081635162 11:44716331-44716353 CTGTTTATTGAACCCCTACCAGG + Intergenic
1085795929 11:79539887-79539909 CCCTCTATGAAACCCATACCAGG + Intergenic
1086103139 11:83122405-83122427 CTATTTAACAAATCAATACCAGG + Intergenic
1088769203 11:113016105-113016127 CAATTTATGAAGCCCATTCATGG + Intronic
1089048947 11:115529138-115529160 CTATTTCTGAAACACAAACATGG - Intergenic
1089334259 11:117712259-117712281 CTCTTCCTGAAACCCAAACCTGG + Intronic
1090867731 11:130716857-130716879 CTGCTTATGAAAACCATGCCTGG + Exonic
1096310037 12:50512686-50512708 ATGTTGATGAAACTCATACCTGG - Intronic
1100536190 12:95511773-95511795 TTATTTAGTAAAGCCATACCTGG + Intronic
1100873507 12:98938151-98938173 ATATTTATGAAATACATACCAGG - Intronic
1105312901 13:19229164-19229186 CTATATCTGAAAACCCTACCTGG + Intergenic
1109758331 13:66792366-66792388 CTTGTTATAAAACCCAAACCTGG + Intronic
1111751555 13:92337931-92337953 CAATTTATGAAAGCAATAACTGG + Intronic
1118472476 14:66087640-66087662 CTATTTTTAAAACCCTGACCAGG - Intergenic
1118822501 14:69354421-69354443 GTCTTTATGAAACACACACCTGG + Exonic
1119930955 14:78546082-78546104 CTATTTATCAACCCCATTCCTGG - Intronic
1120556690 14:85936797-85936819 ATATTTGTGAAACACATATCTGG - Intergenic
1121786710 14:96667205-96667227 CTGTGTATGAGACCCATAACAGG + Intergenic
1127734434 15:61828294-61828316 CTATGTTTGAAACACTTACCAGG - Intergenic
1129491657 15:75932411-75932433 CGATTTCTGAAACCCATATCCGG - Intronic
1131315260 15:91329928-91329950 ATATTTAGGAAAACAATACCTGG - Intergenic
1131396492 15:92090795-92090817 CTATTTAACAAACCCTTCCCTGG + Intronic
1135822922 16:25700516-25700538 TTATTTTTGAAAATCATACCAGG + Intronic
1137747112 16:50830696-50830718 CTATGTATTAGACCCATCCCTGG + Intergenic
1138384930 16:56629744-56629766 CTATTTATTAAACCCTAGCCAGG - Intergenic
1140694096 16:77514729-77514751 CCATTTAAGAAAGCCATGCCTGG + Intergenic
1140758592 16:78091042-78091064 CTATCTATAAAATCCATGCCTGG - Intergenic
1153009231 18:522987-523009 ATATTCATGCAACCCCTACCAGG + Intergenic
1153942067 18:9987174-9987196 TTATTTATGAAACCTCTACTTGG + Intergenic
1155283596 18:24266151-24266173 CTGTTACTGAAACCCATGCCTGG + Intronic
1158657817 18:59356529-59356551 CTAATTCTGAAACCCATGCTGGG + Intronic
1158801505 18:60915983-60916005 TTATTCATGCAACCCAAACCAGG + Intergenic
925762104 2:7195102-7195124 CTACTCAAGAAACCCATACAGGG - Intergenic
926278164 2:11421679-11421701 CCATTTATTGAGCCCATACCAGG - Intergenic
927119821 2:19947823-19947845 CTATTTATGAAAGCAGTACAGGG - Intronic
927789599 2:26000082-26000104 CGATTTTTAAAACCCAAACCTGG + Intergenic
930712525 2:54562426-54562448 CTTTTTATAAAACCCATCCCTGG + Intronic
940391454 2:153137297-153137319 CTATCTGTCAAACCCATAGCTGG - Intergenic
940586299 2:155656199-155656221 CCATTTGTGAAGCCCTTACCAGG + Intergenic
940887397 2:159001578-159001600 CCATTTATGAAACCCTTTCCTGG + Intronic
941576019 2:167231305-167231327 CTCTTTATGATACCCTTAACAGG + Intronic
943682659 2:190784713-190784735 CTATATAGGACACACATACCCGG - Intergenic
944917242 2:204373614-204373636 ACATTTATTAAACACATACCTGG - Intergenic
1170396014 20:15926365-15926387 ATATTTATTGAACCCCTACCAGG + Intronic
1175706908 20:61185944-61185966 GTATATATGAAACGCATCCCAGG + Intergenic
1176909597 21:14548433-14548455 ACATTTATGAGACCCATATCTGG + Intronic
1177763365 21:25428617-25428639 CTACTTATGAAAACCTTACAAGG + Intergenic
1178636766 21:34310549-34310571 CAATTCATGAAACTCAGACCTGG + Intergenic
1180282304 22:10713640-10713662 CTATTTATAGAACGCCTACCAGG + Intergenic
1183915750 22:41117429-41117451 CTATTTATCAAACCTAATCCAGG - Exonic
951270936 3:20623101-20623123 ATATTTAGGATACCCATCCCAGG + Intergenic
955146174 3:56322414-56322436 CTATTAATTAAAGCCATTCCAGG - Intronic
959466326 3:106692007-106692029 CTAAATAAGAAACTCATACCAGG + Intergenic
961753598 3:129112979-129113001 TTATTTATCAAACCCACCCCTGG + Intronic
965675173 3:171187189-171187211 CTAATCATGATACCCATATCTGG + Intronic
968438284 4:607298-607320 CTATTTAAGAAACACATTTCTGG + Intergenic
969475129 4:7418006-7418028 ATGTTTATGAAGCCCTTACCAGG + Intronic
971558060 4:28038643-28038665 ATAGTTATAAAACACATACCTGG + Intergenic
973307093 4:48664564-48664586 TTCTTTATGTGACCCATACCGGG - Intronic
974816895 4:67016598-67016620 CTATTTATGAAAGTCATACATGG + Intergenic
975106678 4:70575044-70575066 CTATTTAGGAAGCCCATATTTGG - Intergenic
980171505 4:129295331-129295353 CTACTTATGGAATCCATAGCTGG + Intergenic
982435285 4:155377781-155377803 CTAGTAATTAAACTCATACCTGG + Intergenic
988727946 5:33942420-33942442 CTAATGATGACACCCAGACCAGG - Intergenic
993239741 5:85367213-85367235 CTATTTTAGAAACCCTTGCCTGG - Intergenic
993866267 5:93200218-93200240 CTATTTATGACATGCATACTAGG + Intergenic
999587050 5:153101239-153101261 CTATTTATGTACCCTGTACCTGG + Intergenic
1000194200 5:158942239-158942261 GTATATATGAAACCCCTATCTGG + Intronic
1004679696 6:17881162-17881184 CAACTTATAAAACTCATACCAGG + Intronic
1006663204 6:35667234-35667256 CTATTTATGGAACACTTACTAGG + Intronic
1006784746 6:36658756-36658778 ATATTTATTAAACATATACCAGG - Intergenic
1007271283 6:40639183-40639205 CTATTTCTAAAACTCATTCCAGG - Intergenic
1007772332 6:44201713-44201735 ATATTTATGAGACACCTACCTGG + Intergenic
1008260715 6:49363232-49363254 ATATTTATGAAATCCCTACTAGG + Intergenic
1014748883 6:125232430-125232452 CTGTTTATGATACCCATTCCAGG + Intronic
1015204548 6:130619919-130619941 CTATTTCTGAATCCCCTGCCAGG - Intergenic
1016382778 6:143501967-143501989 CTATTTATGAAACCCATACCTGG - Exonic
1016404300 6:143714362-143714384 CTATAACAGAAACCCATACCAGG - Intronic
1019626181 7:2016720-2016742 CTAATTATGAAGTCCACACCAGG - Intronic
1019892985 7:3961796-3961818 GTATTTATAAAACTCATGCCCGG - Intronic
1021064360 7:16155208-16155230 CTATTTATGACACTGATAGCTGG - Intronic
1030066837 7:105666106-105666128 CAATTTAAGAACCCCATAGCGGG - Intronic
1030683569 7:112459052-112459074 CTATTCATGACACCCAGACGTGG + Intronic
1031147110 7:118008775-118008797 CTATTTAAGAAATCCAGACTAGG + Intergenic
1032208157 7:129887530-129887552 CTATTAATGAGGCCCATGCCTGG + Intronic
1033018703 7:137699331-137699353 CTCTTTATTTACCCCATACCAGG - Intronic
1037013581 8:13875360-13875382 ATATTTATCAAGCCCATGCCTGG + Intergenic
1038419609 8:27424141-27424163 TTATTTATGGATCTCATACCTGG + Intronic
1039252817 8:35685314-35685336 GAATTTATGAAAGCCATACTTGG - Intronic
1045160466 8:99536641-99536663 CAGTTTATCAAACCCATACTTGG - Intronic
1046261089 8:111768493-111768515 CTATTTCTCAAAGCCAAACCTGG + Intergenic
1047369763 8:124246646-124246668 CCATCTATGAAATCCTTACCAGG + Intergenic
1049467681 8:142759754-142759776 GTATTTATGAATCCCAATCCCGG + Intergenic
1050306001 9:4306631-4306653 CTATTTCTGAATGCCATTCCAGG - Intronic
1055858375 9:80719260-80719282 CTATTTATGAAATACACTCCTGG - Intergenic
1057024066 9:91722627-91722649 CTATTTGTAAATCCCACACCCGG - Exonic
1060355918 9:122906805-122906827 CTCTTTATGAAACATATGCCAGG + Intergenic
1062739159 9:138157949-138157971 GTAATTATGAAAACCATCCCAGG - Intergenic
1190780949 X:53594227-53594249 CTATTTTAAAAACCCATACTTGG + Intronic
1192413330 X:70954274-70954296 CTATTTTTGAAAACCACAACTGG + Intergenic
1198216505 X:134560248-134560270 CTATTTATCATCCCCATCCCCGG + Intergenic
1200427571 Y:3038379-3038401 CTATTTAACAAACCTATACTTGG + Intergenic