ID: 1016385304

View in Genome Browser
Species Human (GRCh38)
Location 6:143525039-143525061
Sequence CACAGGTTTCAGATTAAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016385304_1016385307 11 Left 1016385304 6:143525039-143525061 CCAGGCTTAATCTGAAACCTGTG No data
Right 1016385307 6:143525073-143525095 AAGCATGGCCTGCTCTGCACAGG No data
1016385304_1016385306 -4 Left 1016385304 6:143525039-143525061 CCAGGCTTAATCTGAAACCTGTG No data
Right 1016385306 6:143525058-143525080 TGTGATCATTGAAACAAGCATGG No data
1016385304_1016385310 26 Left 1016385304 6:143525039-143525061 CCAGGCTTAATCTGAAACCTGTG No data
Right 1016385310 6:143525088-143525110 TGCACAGGGTTCAAATGAATAGG No data
1016385304_1016385308 12 Left 1016385304 6:143525039-143525061 CCAGGCTTAATCTGAAACCTGTG No data
Right 1016385308 6:143525074-143525096 AGCATGGCCTGCTCTGCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016385304 Original CRISPR CACAGGTTTCAGATTAAGCC TGG (reversed) Intergenic
No off target data available for this crispr