ID: 1016385305

View in Genome Browser
Species Human (GRCh38)
Location 6:143525056-143525078
Sequence ATGCTTGTTTCAATGATCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016385305_1016385308 -5 Left 1016385305 6:143525056-143525078 CCTGTGATCATTGAAACAAGCAT No data
Right 1016385308 6:143525074-143525096 AGCATGGCCTGCTCTGCACAGGG No data
1016385305_1016385307 -6 Left 1016385305 6:143525056-143525078 CCTGTGATCATTGAAACAAGCAT No data
Right 1016385307 6:143525073-143525095 AAGCATGGCCTGCTCTGCACAGG No data
1016385305_1016385310 9 Left 1016385305 6:143525056-143525078 CCTGTGATCATTGAAACAAGCAT No data
Right 1016385310 6:143525088-143525110 TGCACAGGGTTCAAATGAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016385305 Original CRISPR ATGCTTGTTTCAATGATCAC AGG (reversed) Intergenic
No off target data available for this crispr