ID: 1016385308

View in Genome Browser
Species Human (GRCh38)
Location 6:143525074-143525096
Sequence AGCATGGCCTGCTCTGCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016385304_1016385308 12 Left 1016385304 6:143525039-143525061 CCAGGCTTAATCTGAAACCTGTG No data
Right 1016385308 6:143525074-143525096 AGCATGGCCTGCTCTGCACAGGG No data
1016385305_1016385308 -5 Left 1016385305 6:143525056-143525078 CCTGTGATCATTGAAACAAGCAT No data
Right 1016385308 6:143525074-143525096 AGCATGGCCTGCTCTGCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016385308 Original CRISPR AGCATGGCCTGCTCTGCACA GGG Intergenic
No off target data available for this crispr