ID: 1016387212

View in Genome Browser
Species Human (GRCh38)
Location 6:143540145-143540167
Sequence TGGAATCAAAAATAGGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 297}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016387212_1016387216 5 Left 1016387212 6:143540145-143540167 CCTTGCTCCTATTTTTGATTCCA 0: 1
1: 0
2: 2
3: 34
4: 297
Right 1016387216 6:143540173-143540195 TTGTCAGATGTTCTTCCTAAGGG 0: 1
1: 0
2: 1
3: 16
4: 165
1016387212_1016387215 4 Left 1016387212 6:143540145-143540167 CCTTGCTCCTATTTTTGATTCCA 0: 1
1: 0
2: 2
3: 34
4: 297
Right 1016387215 6:143540172-143540194 GTTGTCAGATGTTCTTCCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016387212 Original CRISPR TGGAATCAAAAATAGGAGCA AGG (reversed) Intronic
900711124 1:4115058-4115080 TGGAAGCAACATTAAGAGCAAGG - Intergenic
900715650 1:4141816-4141838 TGGAGTCAGGAAAAGGAGCAGGG + Intergenic
902075364 1:13780594-13780616 TGGACTCAACAGTAGGGGCAGGG - Exonic
904353197 1:29922234-29922256 AGGAATTTAAAACAGGAGCAGGG - Intergenic
905491708 1:38349351-38349373 GGGAATTAAAACTAGGACCAGGG + Intergenic
905983121 1:42250050-42250072 TGGACTTGAAAATAGGACCACGG + Intronic
906740349 1:48176609-48176631 TGAAATCAAAAATACAAACAAGG + Intergenic
907901347 1:58744200-58744222 TGGAATCAACAATTGCAGAAGGG + Intergenic
909102983 1:71374077-71374099 TGGAATAAAAAATGTGACCAGGG - Intergenic
909768074 1:79383301-79383323 TGGAGTCCAAAACATGAGCAAGG - Intergenic
910337106 1:86147032-86147054 TAGAATCAAAAACAGAATCAGGG - Intronic
910670660 1:89769557-89769579 AGGAATCAAAAATAGTAGAAGGG - Intronic
912102492 1:106228332-106228354 TGGAATTAAAAATAAAACCAAGG - Intergenic
912220857 1:107673472-107673494 TGGAATCCAGGATATGAGCAGGG - Intronic
912866470 1:113262351-113262373 TTGAATTAAAACTATGAGCAGGG - Intergenic
913223295 1:116676738-116676760 AGGAAGCAAAAATAGAAGCAAGG + Intergenic
915025850 1:152828831-152828853 TGGATTAAAAAATAAGTGCAGGG - Intergenic
916775860 1:167963382-167963404 GGAAAACAAAAATAGGAACAAGG - Intronic
916889221 1:169100433-169100455 TGGAATCCAGACTAGAAGCAAGG + Intergenic
917198146 1:172488118-172488140 TGGAATCAAAAATGGGAGAGGGG + Intergenic
917786853 1:178468336-178468358 TGAAATAAAAAATGAGAGCAAGG + Intronic
918385372 1:184002021-184002043 AGGAAGATAAAATAGGAGCAAGG - Intronic
918822758 1:189277952-189277974 TGTAATCAGAAATAAGAGGATGG + Intergenic
920263598 1:204706241-204706263 TGGAATCAAAATTGGCTGCAGGG + Intergenic
921282580 1:213581873-213581895 TGAAATCAAAATCAGGAGAAAGG - Intergenic
923205604 1:231755897-231755919 TGGAATCAGAAATACCAGCAAGG - Intronic
924304140 1:242670082-242670104 TGGAAACAAAAATATGAACTTGG - Intergenic
924438746 1:244069398-244069420 TGGAATCCAAAAGAGGAATATGG + Intergenic
924885612 1:248212735-248212757 TGGAAACAAAGACAGGAGCCTGG - Intergenic
1064285883 10:13990840-13990862 TGGAAAGAAAAATGGGAACAAGG - Intronic
1066406642 10:35125799-35125821 AGGAATAAAGAATAGCAGCATGG - Intergenic
1066553443 10:36584878-36584900 TAGAAACAAAAATAGGACAAAGG + Intergenic
1066764559 10:38790843-38790865 TGGAATCAAAAAGAATAGAATGG - Intergenic
1066774942 10:38877968-38877990 TGGAATCAAAAAGAATAGAATGG + Intergenic
1066971450 10:42315426-42315448 TGGAGTCAAAAGGAGTAGCATGG - Intergenic
1070217764 10:74404270-74404292 TTTAAACAAAAATAGCAGCAAGG - Intronic
1071762144 10:88620247-88620269 TGGAATCCAAAATAGGATTCTGG + Intergenic
1071920234 10:90341683-90341705 TGGAATCAAGAACAGGAAAAAGG + Intergenic
1073354119 10:102840349-102840371 TGGCATCAAAAAGAGGAAAATGG + Intergenic
1074036018 10:109739364-109739386 TGGAATCATAAATTGGAACCTGG + Intergenic
1076273102 10:129173682-129173704 TGAAATAAATAATATGAGCATGG - Intergenic
1076576139 10:131470193-131470215 GGAAGACAAAAATAGGAGCAAGG - Intergenic
1076592506 10:131595092-131595114 TGAAATAAAGAATAGGAACATGG - Intergenic
1076592825 10:131599793-131599815 TGAAATAAAGAATAGGAACATGG - Intergenic
1079793470 11:24768731-24768753 TGGTATCAAAAAGAGAAGTAAGG + Intronic
1079876380 11:25862536-25862558 TGAAATTAAAGTTAGGAGCAGGG - Intergenic
1080611077 11:33904437-33904459 TGGAATAGAAAACAGGAGTAAGG - Intergenic
1080814461 11:35740652-35740674 CAGAATCAAAAATAGAAGCTAGG - Intronic
1081015696 11:37876959-37876981 TGGAAGCAAAAATATGATTATGG + Intergenic
1082765646 11:57165498-57165520 TGGAATGCAAAGGAGGAGCAAGG + Intergenic
1086114796 11:83237501-83237523 TGGAATCTAAACTAGGAGTGTGG + Intronic
1087414708 11:97839329-97839351 TGGAATGAAAAAAAGAAGAAAGG + Intergenic
1087680410 11:101213466-101213488 TGGCATCAAAAAGAGGAAGAGGG + Intergenic
1088014180 11:105038578-105038600 TGGAAGGCAAAAGAGGAGCAAGG - Intergenic
1088063221 11:105682596-105682618 TGGAATTGTAAGTAGGAGCAGGG - Intronic
1088736730 11:112733742-112733764 TGGAAAGAAAAAGAGGAGAAAGG - Intergenic
1088851342 11:113705933-113705955 TCCACTCAAAAAGAGGAGCAAGG - Intronic
1089999201 11:122939422-122939444 TGGAATCTAAGTTAGCAGCAGGG - Intronic
1090673929 11:128971656-128971678 TGGAATCAAAGGTAGGAGAGAGG - Intronic
1091657960 12:2359663-2359685 TGGGTTGGAAAATAGGAGCATGG + Intronic
1093011661 12:14113360-14113382 TGAAATCAGAAATACGAGGAAGG + Intergenic
1093229993 12:16532233-16532255 TGGAATCAGAAATGGGAGAGAGG - Intronic
1093990381 12:25583521-25583543 TGATATCTCAAATAGGAGCAAGG - Intronic
1096889301 12:54750668-54750690 TGGAAAGACAAATAGGAGTAGGG - Intergenic
1098326232 12:69305362-69305384 TGGAGTCATAAATAAGATCAAGG - Intergenic
1099440607 12:82694923-82694945 TGGAATCACAATTAGGAAAAAGG - Intronic
1099626038 12:85075488-85075510 TGCAAGCAAAAGCAGGAGCAAGG + Intronic
1100915268 12:99413790-99413812 TGCAATCCCACATAGGAGCAAGG + Intronic
1101050526 12:100858799-100858821 TGGAAGCAGAAAAAGAAGCAGGG - Intronic
1102279327 12:111606346-111606368 TAATATCAAAAATAGGACCATGG + Intergenic
1103174085 12:118846733-118846755 TGGAATGAACAATAGGAAAATGG + Intergenic
1105513985 13:21075044-21075066 AGGAGTCAAAAGTAAGAGCAGGG + Intergenic
1107036565 13:35908598-35908620 TGAAATCCATAATAGGAGCTGGG - Intronic
1107399271 13:40053220-40053242 TTGGGTCAAAAATAGGAGTAAGG + Intergenic
1108542202 13:51454599-51454621 TGGACTACAAAATAAGAGCATGG + Intergenic
1108555416 13:51586362-51586384 TGGAATCAAGAAAAGGAGAAGGG + Intronic
1108605978 13:52039018-52039040 TGGAATAACCAATAGGAGCCAGG + Intronic
1109365156 13:61345135-61345157 TGTAATAAAAAATACGAGTAAGG - Intergenic
1109822351 13:67674409-67674431 TGCTATCAAAAATTGGAGGATGG + Intergenic
1110366876 13:74696622-74696644 TAGAATCAGAAATGGGAGGAGGG - Intergenic
1110708418 13:78622702-78622724 TGTAATCAAAAAGAGGAGTTAGG - Intronic
1113148546 13:107236420-107236442 TGGGATAAAAAATAGGAGCATGG + Intronic
1113387654 13:109863938-109863960 TGCAATCAACAATTGGAGAATGG + Intergenic
1113715153 13:112499617-112499639 GGTAATCAAAAATATGAGAAAGG + Intronic
1114799258 14:25754418-25754440 TGCAGGCAAAGATAGGAGCAAGG - Intergenic
1115618595 14:35119817-35119839 GGGACTCTTAAATAGGAGCATGG + Intronic
1116971971 14:51075696-51075718 TGGAATTAAAAATGGCAGCGGGG + Intronic
1118124586 14:62887071-62887093 TTTAAGCAAAATTAGGAGCAAGG - Intronic
1118258143 14:64222976-64222998 AGAAATTAAAAATAGGGGCAGGG + Intronic
1118625392 14:67654262-67654284 AAAAATCAAAAAAAGGAGCAGGG - Intronic
1118990995 14:70796816-70796838 GGGAGTGAAAAATAGGAGCCTGG + Intronic
1119674566 14:76544237-76544259 TGGTTTTAAAGATAGGAGCAGGG - Intergenic
1119794574 14:77384413-77384435 TGGATTAAAAAATGGGAGAAAGG - Intronic
1119963557 14:78887501-78887523 TGGACTCAAACATAAGTGCATGG + Intronic
1120047004 14:79819231-79819253 TGGAAACAAATAAATGAGCAGGG + Intronic
1120701995 14:87708103-87708125 GGGAATGAAAAATATGAGCCAGG - Intergenic
1124787553 15:32695849-32695871 TGGTATCTAAATTAGTAGCAAGG + Intronic
1126288598 15:47045157-47045179 AGGACTCAAATATAGGAGTATGG + Intergenic
1126685142 15:51241863-51241885 TGGGATCAGAAGTGGGAGCATGG - Intronic
1126822638 15:52520028-52520050 TGGATTGAAAAATAGAAGCCAGG - Intronic
1127380501 15:58427098-58427120 TGGAATCAACACTAGGGTCAAGG - Intronic
1129202575 15:74012695-74012717 TGGAACCAAAACTAGAAGGATGG - Intronic
1129784225 15:78298229-78298251 TAGAAACAAAAAAAGGAGGAAGG + Intronic
1130735640 15:86545656-86545678 TGGAAAAGAAAATAGGAACAAGG - Intronic
1131980445 15:97989472-97989494 AGGAAGCTAAAATAGGAACAAGG + Intergenic
1133377478 16:5299592-5299614 TGTAATCAAAAATAATGGCAAGG - Intergenic
1133450833 16:5902764-5902786 TGGAATCAAAAAAAGGAGGGTGG - Intergenic
1133859194 16:9577999-9578021 TGGGATCCAAAATAGCAGCGTGG + Intergenic
1135325494 16:21522915-21522937 TGGAAGCAACAGTAGGAGCCGGG + Intergenic
1135490773 16:22907416-22907438 GGGAAAAAACAATAGGAGCATGG + Intronic
1135925541 16:26690437-26690459 TGGTATCACAATTACGAGCATGG + Intergenic
1138436098 16:57000901-57000923 AGGAAACAAAACTAAGAGCAGGG - Intronic
1140223477 16:73060365-73060387 TGGAATCAAAGACAGCAGCGAGG + Intergenic
1140378006 16:74460676-74460698 TGGCATCCAATATAGGAGGAGGG - Intronic
1141676534 16:85520722-85520744 TGAGAATAAAAATAGGAGCAGGG - Intergenic
1142038492 16:87877502-87877524 TGGAAGCAACAGTAGGAGCCGGG + Intergenic
1145328875 17:21854223-21854245 TGGAATCGAAAAGAAGAGAATGG + Intergenic
1145412902 17:22688928-22688950 TGTAATAAAAACTAGAAGCAAGG - Intergenic
1145704373 17:26858544-26858566 TGGAATCAAAAATAATAGAATGG + Intergenic
1145828627 17:27897194-27897216 TGGGATCTAAAGGAGGAGCAGGG - Intergenic
1148396128 17:47309480-47309502 GGGAATGGAAAATAGGAGAAGGG + Intronic
1150601505 17:66654789-66654811 TGGAAATAAAAATGGCAGCAGGG + Intronic
1151458432 17:74240511-74240533 TGGAAGCAAAGACAGGAGAAGGG - Intronic
1151806253 17:76407425-76407447 TGAAGTCTAAAATGGGAGCAGGG - Intronic
1152478234 17:80532443-80532465 TAGAAGCAGAAACAGGAGCAGGG - Intergenic
1152746267 17:82040991-82041013 TGGCATCAAAAAGAGGAAAAGGG + Intergenic
1203194604 17_KI270729v1_random:220074-220096 TGGAATCAAAAGTAATAGAATGG + Intergenic
1203203961 17_KI270730v1_random:19480-19502 TGGAATCAAAAGTAATAGAATGG + Intergenic
1203205736 17_KI270730v1_random:34636-34658 TGGAATCGAAAAGAAGAGAATGG + Intergenic
1153179064 18:2412380-2412402 TGCAATTAAACATAGGAGGATGG - Intergenic
1154982513 18:21515027-21515049 TCAAATCCAAAATAGGAACAAGG - Intronic
1155298676 18:24408968-24408990 TGGAAGCAAGAATACCAGCAAGG + Intergenic
1156572695 18:38276922-38276944 TGGAATGAAAAATTGGTTCAAGG + Intergenic
1156774822 18:40774414-40774436 TGGCATCAAAGATTTGAGCAAGG + Intergenic
1157007250 18:43598239-43598261 AGGACTCAAATATAGAAGCATGG - Intergenic
1157134033 18:45036698-45036720 TGGAATGGAGAATAGGAGGAAGG + Intronic
1164288876 19:23849395-23849417 TGGCATCAAAAAGAGGAAAAGGG + Intergenic
925018106 2:547016-547038 TGCTTTCAAAAATAGGACCACGG - Intergenic
925372552 2:3357421-3357443 AGGACTCAAATATAGAAGCAGGG - Intronic
925803405 2:7625045-7625067 TGGAATGAACAATAGCAGGATGG + Intergenic
926420847 2:12696633-12696655 TGGAAGCAAAGATAGGAACTGGG + Intergenic
926522159 2:13928776-13928798 AGGACTCAAAAATAGGAGTACGG - Intergenic
926809265 2:16741899-16741921 TGAAATCAAAAAGAAGAGCTTGG - Intergenic
927384084 2:22513031-22513053 TGGAATCAAAATTATCACCAAGG - Intergenic
928373730 2:30759010-30759032 GGGAAGGAAGAATAGGAGCAGGG - Intronic
928866353 2:35921638-35921660 TGGAATCACTAATTGCAGCAGGG - Intergenic
929301305 2:40306538-40306560 TGGAATCCAAAATAGGCCAATGG + Intronic
930922683 2:56776741-56776763 TGGAAAAAAAATTAGGAGAATGG - Intergenic
930996512 2:57725765-57725787 TGGAATCAAAGAAAAGAGAAAGG + Intergenic
931734172 2:65178865-65178887 TGGCATGAAAAATAGGAAGAAGG - Intergenic
932616753 2:73236657-73236679 AGGAATAAAAAAAAGGAGCGAGG + Intronic
935351510 2:102155052-102155074 TGGGAACAAAAACAGGAACAAGG - Intronic
935542346 2:104363296-104363318 TGGAAGAAAAAATAGAACCAGGG - Intergenic
935646476 2:105339916-105339938 TCCCATCAAAAATATGAGCAGGG - Intronic
937105748 2:119311158-119311180 TGGAATTTAAAATAGGAACCTGG - Intronic
939795378 2:146637641-146637663 ATGAAACAAAAATAGTAGCAAGG + Intergenic
940734675 2:157437114-157437136 TGGAATAAAACATAGGGGAAAGG + Intronic
940958057 2:159750960-159750982 TAAAATGAAAAATAGGAGTATGG - Intronic
942243176 2:173982862-173982884 TGGTATAAAAAATAGTAACAGGG + Intergenic
942251148 2:174048699-174048721 TGGAGGCAAAAATAGGCACACGG + Intergenic
943803514 2:192092163-192092185 TTCAATCAGAAATAGGAGAAAGG - Intronic
944949063 2:204726417-204726439 TGGACTGAAAAATAAAAGCATGG + Intronic
946759503 2:222979161-222979183 TGGGTTCAGAAATAGAAGCAAGG - Intergenic
947579202 2:231302180-231302202 TGAAACCAAAAATTGGAGAATGG - Intronic
947978640 2:234388860-234388882 TGGATTTAAAAAATGGAGCATGG + Intergenic
948030057 2:234810038-234810060 TGGAGGCAAAACCAGGAGCAAGG - Intergenic
948932343 2:241140059-241140081 AGGAATCACAAAGAGGAGCAAGG + Intronic
1169585007 20:7071918-7071940 TGGAATTAAAAATACAAGAATGG - Intergenic
1169748959 20:8972322-8972344 TGGCATGAAAAAAAGGAGGAGGG - Intergenic
1169810237 20:9602373-9602395 TGGTAGCAACATTAGGAGCAAGG - Intronic
1169939795 20:10924675-10924697 TGGAATAAAAGATATTAGCATGG - Intergenic
1170001206 20:11616153-11616175 TGGGCTCAAAGATATGAGCAAGG + Intergenic
1170230989 20:14045776-14045798 GGGAATTAAAAACATGAGCAGGG + Intronic
1170622235 20:18005796-18005818 TGGAATGACAAATAGCAGGATGG - Intronic
1171915458 20:31059104-31059126 TGGAATCAAAAATAGTGTAATGG + Intergenic
1173379063 20:42521149-42521171 TGGAATCAGAAATATCAGAATGG - Intronic
1173574881 20:44106319-44106341 TGGAGGCAGAGATAGGAGCAGGG + Intergenic
1174001464 20:47378121-47378143 TGGAAAAAAATATAGCAGCAAGG + Intergenic
1176956731 21:15113733-15113755 TTGAATCAAAAATAGGAAAATGG - Intergenic
1177590646 21:23161569-23161591 TGGTATAATAAATAAGAGCAGGG - Intergenic
1178405778 21:32322084-32322106 TGGAATCAAAGATGAGATCAGGG - Intronic
1178943127 21:36924163-36924185 TAGGATTAAAAATAGGAGAAGGG + Intronic
1181556929 22:23676532-23676554 TGGAGTCAATATTAGGATCACGG + Intergenic
1184840596 22:47050393-47050415 TGGAAATAAAAATAGAATCAGGG - Intronic
951040838 3:17987511-17987533 TGGAATCAGAAAGAGGAGAGAGG - Intronic
951275162 3:20676302-20676324 GGGAATCAAAATTGGGAGAAAGG + Intergenic
952471150 3:33652999-33653021 AGAAGTCAAAAATAGAAGCAAGG - Intronic
952598274 3:35045221-35045243 TGGAATAAAAAATAGGAAAGGGG - Intergenic
953063110 3:39444116-39444138 GGCAATCAAAAAAAGGACCATGG - Intergenic
953396847 3:42580155-42580177 TGGAAGAAAAAACAGGATCAAGG - Intronic
955602736 3:60664933-60664955 TGGAATTAAAAATAAGAAAAAGG - Intronic
955964055 3:64369984-64370006 TGGAAACAAACAAATGAGCAAGG + Intronic
958491868 3:94785573-94785595 TGGAATGAAAACTAGAACCAAGG + Intergenic
959698408 3:109274417-109274439 GGGGATCAAAACCAGGAGCAAGG + Intergenic
959914190 3:111797565-111797587 TGGTAGCAAAAATAGAACCAAGG - Intronic
962482578 3:135810403-135810425 AGGAATCAAGAACAGGACCAAGG + Intergenic
962645976 3:137440761-137440783 TGAAGTCTAAAATAGAAGCAAGG - Intergenic
963176141 3:142299501-142299523 TGGAAGCAGAAATAGCAGGAAGG + Intergenic
964194796 3:154050263-154050285 TGACATCAAAAAAAGGATCAAGG + Intergenic
964389414 3:156182259-156182281 TGAGATACAAAATAGGAGCAGGG - Intronic
965156839 3:165070977-165070999 TGGAAGCAAAAATTGGAAAAAGG - Intronic
966462187 3:180189065-180189087 GTGAATCAATAATAGGAGAATGG - Intergenic
966483052 3:180432930-180432952 TAGCATCAAAAATAGGAAGAAGG + Intergenic
968805563 4:2769526-2769548 GGAAATTAAAAATAGGATCATGG + Intergenic
970080933 4:12284422-12284444 TGCAATAAAAACTAGAAGCAAGG - Intergenic
971685487 4:29760655-29760677 TGGAATTAAAAATAGTAATAAGG + Intergenic
972353846 4:38262135-38262157 GGGAAACAAAAATACGAGCTGGG - Intergenic
972373836 4:38451694-38451716 TGGCAAAAAAAATAGGAGCAAGG + Intergenic
973828350 4:54732500-54732522 TGGAACCAAAACAAGGAGCATGG + Intronic
973880539 4:55267399-55267421 TGGAATCTAAAATATGAGCATGG + Intergenic
974592586 4:63972970-63972992 TGAAATGAAACATAGGAGGAAGG + Intergenic
975919334 4:79365664-79365686 TGGAAACAGAAATAGGAACAGGG - Intergenic
976774139 4:88688803-88688825 TGAAATGAAAAACAAGAGCAAGG + Intronic
976959317 4:90948119-90948141 TGGAAAAAAAAATAGTACCAAGG - Intronic
977092135 4:92690926-92690948 TGGAAACAAAAATAGTTGGAAGG + Intronic
977186449 4:93943827-93943849 TAGAATCAGACATACGAGCAAGG + Intergenic
977819665 4:101457670-101457692 TGGAAAAAAAAAAAAGAGCAGGG - Intronic
978123273 4:105107323-105107345 TGGCATCAAAAGTGGGAACAAGG - Intergenic
978679040 4:111355708-111355730 TGGAATTAAAAATTGGAGATAGG + Intergenic
979791629 4:124789961-124789983 TGGAATTAATAATAAGAGGAAGG + Intergenic
979981316 4:127258728-127258750 GGGAGTCAAAGGTAGGAGCAAGG - Intergenic
980315789 4:131198329-131198351 TGGACTTAAAAATAAGAGAAGGG - Intergenic
981233379 4:142386437-142386459 AGGACTCAAATATAGAAGCATGG - Intronic
982833214 4:160089503-160089525 TGGAAAAGAAAATAGGATCAAGG + Intergenic
983032169 4:162816368-162816390 TGGAATAAAAAATTGGAGGTGGG + Intergenic
983110966 4:163748769-163748791 TGGAAACAGATATAGCAGCAGGG + Intronic
987520092 5:18970633-18970655 TTGAATCAAAAAGAGAAACATGG + Intergenic
988418372 5:30974820-30974842 TGGAAATAAAAAGAGGACCAAGG - Intergenic
989148671 5:38275111-38275133 AGGAATCAAAAATACTACCAGGG + Intronic
989424420 5:41279594-41279616 TGGATCCGAAAATAGGAGCCTGG - Intergenic
989723893 5:44563833-44563855 AGGAATCAAAAATAGAAAAAAGG - Intergenic
990124756 5:52500668-52500690 TAGAATCAAAAATAGTAGAGAGG - Intergenic
992846646 5:80756042-80756064 TAGAATAAAAAATATGAGCATGG + Intronic
993177551 5:84507511-84507533 TGGAAGCAAAGAAAGGAGCAAGG + Intergenic
993820766 5:92613577-92613599 CAGAATCAAAAATAAGACCATGG + Intergenic
994945088 5:106377389-106377411 TGGAATCAATAATTGGAGTAAGG - Intergenic
994953950 5:106502599-106502621 TGCAATCAAGAGTAGTAGCATGG - Intergenic
995127339 5:108591394-108591416 TGGAAACAACAATATGAGAAAGG - Intergenic
995689629 5:114809951-114809973 TGGAATAAACAATATGAGCAAGG + Intergenic
996012531 5:118497153-118497175 TGAAATAAAAAATTGGAGTAGGG + Intergenic
996860328 5:128058366-128058388 TAGAATGAAAAACAGGACCAAGG - Intergenic
997896420 5:137721893-137721915 AGGAATCAAAAGAATGAGCAAGG + Intronic
998540288 5:142974910-142974932 TGGAATGAAAAGTATGAGAAGGG - Intronic
998543336 5:143004263-143004285 AGGACTCAGATATAGGAGCATGG + Intronic
999631977 5:153580766-153580788 TGGATTCAGGAAGAGGAGCATGG + Intronic
999982631 5:156972533-156972555 AGGAATCAAAAATATCATCAAGG + Intergenic
999997670 5:157107625-157107647 AGGAATCAAAAAGAGGAGGCAGG - Intronic
1001433264 5:171680297-171680319 TGGAACCACAGAAAGGAGCAGGG + Intergenic
1005798114 6:29390059-29390081 TGGAATCAAAGATAGAAAAAAGG + Intronic
1009890576 6:69676043-69676065 TTTCATCAAAAATGGGAGCATGG - Exonic
1010862135 6:80926054-80926076 TGTAACAATAAATAGGAGCATGG + Intergenic
1014084350 6:117325942-117325964 TGGAAGCCTAATTAGGAGCATGG + Intronic
1016071527 6:139744926-139744948 GGGAATGAAAAACAGGAGGAAGG + Intergenic
1016387212 6:143540145-143540167 TGGAATCAAAAATAGGAGCAAGG - Intronic
1017484399 6:154889646-154889668 TGGATGAAAAAAAAGGAGCATGG + Intronic
1018346636 6:162905701-162905723 TGGAAGCTAAATTAGGTGCATGG - Intronic
1018460233 6:163991419-163991441 TTCAATCAAAAAAAGGAGGAAGG + Intergenic
1020559372 7:9710897-9710919 TGCAATCAAAAATAATATCATGG + Intergenic
1020579755 7:9981416-9981438 TGGAAAAAAAAAAAGGAGAAGGG + Intergenic
1023114782 7:36851939-36851961 TGGAAGCAGAAATATTAGCAAGG - Intergenic
1024216294 7:47251924-47251946 TGGAGTCAAAAATGGTAGCTGGG + Intergenic
1024317756 7:48036769-48036791 TGGGGTCTAAAGTAGGAGCAAGG - Intronic
1024912548 7:54462570-54462592 TAGAAACAAAAATTGGAGAATGG + Intergenic
1025726030 7:64061492-64061514 TGGAAACAAAAAAAAGAGCAGGG - Intronic
1028038059 7:86010544-86010566 GTGAATTAAAAAAAGGAGCAAGG - Intergenic
1029335260 7:99893372-99893394 TTGAATCAAAACTAGAACCAAGG + Intronic
1030485583 7:110163033-110163055 GTGAAGCAAAAATAGGAACATGG - Intergenic
1031289812 7:119919510-119919532 AGTAAACAAAAATAGGAGCTTGG + Intergenic
1034398373 7:150845274-150845296 TGGAAGGAAATATAGCAGCATGG - Intronic
1035956490 8:4085986-4086008 TGTAATTAAAAGAAGGAGCAAGG + Intronic
1036529720 8:9573054-9573076 TAGAATCTAAAATATGAGAATGG - Intronic
1037142414 8:15535015-15535037 AGGACTCAAATATAGGAGTATGG + Intronic
1038926994 8:32151674-32151696 TGGAAGCAGAAATCTGAGCAGGG + Intronic
1039167769 8:34704515-34704537 TGGAAACAAAAATAGAACTAAGG - Intergenic
1039170595 8:34740356-34740378 TGGAAAAAAAAAAAGAAGCAGGG + Intergenic
1039561581 8:38516626-38516648 TGGAGATAAAAATAGGATCATGG - Intronic
1040677177 8:49764556-49764578 TGGAATCACAAAAAGGAGCCCGG + Intergenic
1040800014 8:51330057-51330079 TGGAACAAAAAATTGGAGGAAGG - Intronic
1041437433 8:57858117-57858139 TGTAATCAAGACTGGGAGCAGGG + Intergenic
1043155665 8:76776065-76776087 TGGTACCAATAAAAGGAGCAAGG - Intronic
1044371525 8:91417817-91417839 TGGAGTCAAAAATATAGGCAAGG - Intergenic
1044703137 8:94982572-94982594 TGGAATCAGAAATAGGAGTTGGG - Intronic
1045640323 8:104242993-104243015 TGGAATCAATGATATAAGCAAGG - Intronic
1046100237 8:109605467-109605489 TTGAATGAAAAAAAGGAGCAGGG - Intronic
1047298738 8:123594404-123594426 TGGAATCATTACTAGGAGCTGGG - Intergenic
1051614647 9:18995565-18995587 AGGAATCATAAACAGGAGTAAGG - Intronic
1054708058 9:68483095-68483117 TGGAATGAAAAATGGGAGAAAGG - Intronic
1054867992 9:70022795-70022817 TGGAATCAAGAATAGCCGAATGG - Intergenic
1055218875 9:73903554-73903576 ATGAATATAAAATAGGAGCATGG - Intergenic
1055624533 9:78161592-78161614 TCTAATCAACAATAGAAGCATGG - Intergenic
1055690562 9:78826068-78826090 TGGAATTCAAAAAGGGAGCAAGG + Intergenic
1055921848 9:81469145-81469167 TGAAATCAAAAATAATGGCAAGG + Intergenic
1055941985 9:81659226-81659248 TCCAATCAAGAATAGAAGCATGG - Intronic
1056947761 9:91014200-91014222 AGGAATCAAAATTACGAGGAGGG + Intergenic
1057713078 9:97464735-97464757 TGGAACCAAAGATGGCAGCAGGG + Intronic
1059655548 9:116354358-116354380 GGGAATCAAGAATAGGAAAAAGG + Intronic
1059983580 9:119799476-119799498 TGGATTTGAAAATAGGAGGAAGG - Intergenic
1059996785 9:119918333-119918355 ATGAATCAATAGTAGGAGCAGGG - Intergenic
1060582922 9:124768969-124768991 TGGATTCAAAAAAATCAGCATGG + Intronic
1060863725 9:126978130-126978152 TGGTTTCAAAAATAGAAACAAGG - Intronic
1203724503 Un_GL000216v2:38833-38855 TGGAATGAAAAACAGTGGCATGG - Intergenic
1203389217 Un_KI270438v1:82208-82230 TGGAATCAAAATTAATAGAATGG + Intergenic
1203677855 Un_KI270756v1:38311-38333 TGGAATCAAAAAGAATAGAATGG - Intergenic
1186909254 X:14144009-14144031 TGGAACCAACATTAGGAGAAGGG - Intergenic
1187910080 X:24103727-24103749 TGAAAACAAAAATAGGGGCCGGG - Intergenic
1189082917 X:37993663-37993685 TGGAGGCAAAATTGGGAGCAAGG + Intronic
1189231878 X:39458959-39458981 TGGATGCATTAATAGGAGCAAGG + Intergenic
1190451487 X:50585605-50585627 TGGAGGCAAAATTTGGAGCATGG + Intergenic
1190850018 X:54230973-54230995 TGGCATGAAAAAGATGAGCAGGG + Intronic
1191239973 X:58179395-58179417 TGCAATAAAAAATAGAAACAAGG + Intergenic
1191979895 X:66914075-66914097 TGGAAAGAAAAATAGGAGGAGGG + Intergenic
1192375392 X:70555097-70555119 TAGAATCAATAATAGCAGCAGGG - Intronic
1195475324 X:105278529-105278551 AGGAATGAAAACTAGGAGCTTGG + Intronic
1196898756 X:120362706-120362728 TAGAATCCCCAATAGGAGCAGGG + Intronic
1196991887 X:121338739-121338761 TGGAAAAAAAAAAAGGAGCCAGG - Intergenic
1197922209 X:131607366-131607388 AAGAATCAACAGTAGGAGCAGGG - Intergenic
1199326618 X:146505636-146505658 TGGAAACAAAAACAGAAACATGG + Intergenic
1201199240 Y:11524279-11524301 TGGAATCAAAAAGAATAGAATGG + Intergenic
1201200373 Y:11534587-11534609 TGGAATCAAAAATAATAGAAAGG + Intergenic
1201200991 Y:11540158-11540180 TGGAATCAAAAATAATAGAAAGG + Intergenic
1201201377 Y:11543519-11543541 TGGAATCAAAAATAATCGAAAGG + Intergenic
1201201769 Y:11546880-11546902 TGGAATCAAAAATAATCGAAAGG + Intergenic
1201202415 Y:11552504-11552526 TGGAATCAAAAATAATAGAAAGG + Intergenic
1201203728 Y:11563762-11563784 TGGAATCAAAAATAATAGAAAGG + Intergenic
1201204373 Y:11569369-11569391 TGGAATCAAAAATAATAGAAAGG + Intergenic
1201205022 Y:11574971-11574993 TGGAATCAAAAATAATAGAAAGG + Intergenic
1201205672 Y:11580577-11580599 TGGAATCAAAAATAATAGAAAGG + Intergenic
1201206320 Y:11586184-11586206 TGGAATCAAAAATAATAGAAAGG + Intergenic
1201206969 Y:11591786-11591808 TGGAATCAAAAATAATAGAAAGG + Intergenic
1201212914 Y:11696995-11697017 TGGAATCAAAAGGAATAGCATGG + Intergenic
1201215611 Y:11720063-11720085 TGGAATCAAAAGTAGTAGAATGG + Intergenic
1201216702 Y:11729124-11729146 TGGAATCAAAAAGAATAGAATGG + Intergenic
1201218042 Y:11740362-11740384 TGGAATCAAAAAGAATAGAATGG + Intergenic
1201734459 Y:17243273-17243295 TGGAAAGAAAAAAAAGAGCAGGG - Intergenic