ID: 1016388468

View in Genome Browser
Species Human (GRCh38)
Location 6:143551541-143551563
Sequence GAGCTGGGTTTCTCAACACC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 168}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016388464_1016388468 15 Left 1016388464 6:143551503-143551525 CCTTTTGTAGACTAGAAAAAGGT 0: 1
1: 0
2: 2
3: 23
4: 228
Right 1016388468 6:143551541-143551563 GAGCTGGGTTTCTCAACACCCGG 0: 1
1: 0
2: 0
3: 18
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016388468 Original CRISPR GAGCTGGGTTTCTCAACACC CGG Intronic
900137139 1:1122400-1122422 GAGCAGGGGTTCTCAGGACCTGG + Intergenic
901521051 1:9785474-9785496 GATCAGGGTTTCTCAACAGCTGG + Intronic
901712948 1:11130083-11130105 GAGCTGAGGCTCTGAACACCCGG + Intronic
904733220 1:32610916-32610938 CAGCTGGGGTTTTCAACTCCTGG - Intronic
906518571 1:46453842-46453864 GACCAGGGCTTCTCACCACCAGG + Intergenic
907284425 1:53370872-53370894 AAGCTGGGCCTCCCAACACCTGG - Intergenic
907785735 1:57610807-57610829 GAGGTCCGTTTCTCAACATCTGG + Intronic
907880561 1:58546314-58546336 GAGCAGGGTTTCTCACCCGCGGG - Intronic
910824938 1:91396822-91396844 GAGCTGGGATCCCCAACCCCTGG + Intronic
913446647 1:118957346-118957368 GAGCTGGGTTTCTCTAGGGCAGG + Intronic
914454033 1:147818779-147818801 GAGCTGAGTTTCTCAAAATATGG - Intergenic
916597300 1:166256954-166256976 GAGCTGGGTTTCTGAACTCAGGG + Intergenic
919161623 1:193837884-193837906 CAGCTGGGTATCTCAAAACCAGG - Intergenic
920373120 1:205492127-205492149 GGTCTGGGTTTCTCACCTCCCGG + Intergenic
921159339 1:212462339-212462361 GAGCTGGGTCTCACAGCAACTGG + Intergenic
921700139 1:218259837-218259859 GGTCTGGATTTCTCAACCCCCGG + Intergenic
921932668 1:220767878-220767900 AAACTGTGTTTCTCAACAGCTGG - Intronic
923022400 1:230175058-230175080 GAGCTGACTTTCTTAATACCAGG + Intronic
923881185 1:238105543-238105565 GAGCTGGGGAACTTAACACCTGG - Intergenic
924053814 1:240104779-240104801 CTGCTGGGTTGTTCAACACCAGG + Intronic
1064486260 10:15794053-15794075 GAGCTGGGTTTATCAACCAGGGG + Intronic
1066319200 10:34283420-34283442 GAGATGGCTTTCTCACCCCCTGG + Intronic
1067173651 10:43927260-43927282 GAGCTGGGTTTCTCTCCCACTGG + Intergenic
1069256157 10:66334401-66334423 GAGCTCTGTTTGTCACCACCAGG + Intronic
1072844885 10:98818552-98818574 GAGCAGGGATCCACAACACCTGG - Intronic
1073155880 10:101346487-101346509 GAACAGGGTTTCTCAACTTCAGG + Intergenic
1074124508 10:110517413-110517435 GACCAGGGTTTCCCAACCCCTGG + Intergenic
1074541619 10:114369972-114369994 GAACTGGGTATCTCAACTCCAGG - Intronic
1075340747 10:121645277-121645299 GAGCTGGGGTTCTGCACACCAGG - Intergenic
1079390863 11:20020993-20021015 GAGCTGGGTATCTGAATACCTGG - Intronic
1080277105 11:30514906-30514928 GAGATGAGTTTCACCACACCAGG - Intronic
1084549434 11:69832233-69832255 GAGCTGAGTTCCTGACCACCAGG + Intergenic
1084684955 11:70687975-70687997 GAGCTGAGTTCCTCACCACAGGG - Intronic
1084851526 11:71945196-71945218 CAGCTGGGTCTCCCAACTCCTGG + Intronic
1085336661 11:75701906-75701928 GAGCTGGGTCTCTCAATGCAGGG + Intergenic
1085780976 11:79408804-79408826 GAGCTGCCCTTCTCAACTCCTGG - Intronic
1087152958 11:94874865-94874887 GAGATGTGTTTTTCAAAACCAGG + Exonic
1088353802 11:108920676-108920698 GAGCTACCTCTCTCAACACCAGG - Intronic
1088470550 11:110184399-110184421 GACCTGGATTTCCCTACACCAGG - Intronic
1091015619 11:132048653-132048675 GTGCTGGGATTCTCAACTTCTGG - Intronic
1092594838 12:9990012-9990034 GAGCAGTGTTTCTCAACAATGGG - Intronic
1097832892 12:64244276-64244298 CAGCTGTGTTCCACAACACCTGG - Intergenic
1103823979 12:123721338-123721360 GAGCAGGGTCTCTGAAAACCTGG + Intronic
1108196363 13:47999844-47999866 GAGCTGCATTTCTTAATACCAGG + Intronic
1110442887 13:75544972-75544994 TAGCTGTGTTTCTCTAAACCAGG - Intronic
1110818018 13:79882727-79882749 GAGTTGGGCTGCTTAACACCTGG + Intergenic
1110825608 13:79968059-79968081 TAGCAGAGTTTCTCAGCACCTGG + Intergenic
1111654805 13:91139233-91139255 GAGCAGGGTTTCTCAACTGTGGG + Intergenic
1112671715 13:101647532-101647554 GATCTGGGTTTCTCAAGCACTGG - Intronic
1113859918 13:113474902-113474924 GAGCTGTGTTTTACAATACCTGG - Intronic
1121429724 14:93878454-93878476 GCGCCTGGTTTCTCAACCCCTGG - Intergenic
1121999214 14:98632721-98632743 GAGCTGGATATCTCAGGACCAGG + Intergenic
1122650761 14:103225328-103225350 GAGCTGGTTTCATCATCACCAGG + Intergenic
1122759233 14:104009241-104009263 AAACAGGGTTTCCCAACACCTGG + Intronic
1124049226 15:26179527-26179549 GAGCTGGGTTTAAAAACACATGG + Intergenic
1125508523 15:40281083-40281105 TCGCTGGGTTTCCCAACAACTGG - Intronic
1127122938 15:55786787-55786809 GAGCTGGGTCTCTCACCAGTGGG + Intergenic
1127709138 15:61578356-61578378 GTGATGTGTTTCTCAACACTAGG + Intergenic
1127890170 15:63243290-63243312 CAGCAGGGTTTCTCAATCCCTGG - Intronic
1128875062 15:71194955-71194977 GTGCTGGGCTTCGGAACACCAGG - Intronic
1129275837 15:74444676-74444698 GAACTGGGCTTCTCAATGCCAGG - Intergenic
1131271016 15:90947727-90947749 GAGCTGAGCTCCTCCACACCTGG - Intronic
1132153348 15:99477686-99477708 GAGCTGGATGTCTGACCACCTGG - Intergenic
1133985276 16:10663625-10663647 GAGCTGGGACTCTCAACCCTTGG + Intronic
1135384684 16:22027191-22027213 TAACTGCGTTTCTAAACACCTGG + Intronic
1136929903 16:34409608-34409630 AAGCGGGGTTCCCCAACACCCGG - Intergenic
1136974671 16:35002197-35002219 AAGCGGGGTTCCCCAACACCCGG + Intergenic
1138246576 16:55471123-55471145 CTGCTGGGCTCCTCAACACCAGG - Intronic
1140797559 16:78453962-78453984 GATCTGGATTTCACCACACCTGG + Intronic
1141172012 16:81697440-81697462 GAGCTGGTTTTCTCAGCAAGTGG - Intronic
1143431598 17:6891933-6891955 GAGCTGGATTTCACAGGACCTGG + Intronic
1144365577 17:14541454-14541476 GAGCTGGGGTTTTCATCACTGGG - Intergenic
1144523884 17:15973450-15973472 GAACAGGGTTCCTCAACCCCTGG + Intronic
1144656052 17:17037468-17037490 GAGCTGTGGTTCTCAAATCCTGG - Intergenic
1144760115 17:17702372-17702394 CAGCTGGGTTCCTCACTACCAGG + Intronic
1144773852 17:17774366-17774388 GAGCTGGCTTTTTCCAGACCAGG - Intronic
1147364395 17:39950993-39951015 CAGCTGGGAATCTCAAAACCTGG - Intergenic
1148890391 17:50802899-50802921 GAAATGGGTTTCTCAGCTCCTGG + Intergenic
1151247712 17:72807870-72807892 CAGCTGGGCTTCTCACCATCTGG - Intronic
1152014612 17:77742202-77742224 GAGCAGGGTTCCCCAACCCCGGG - Intergenic
1152422390 17:80201034-80201056 GAGCAGGGTTCCCCAACCCCTGG - Intronic
1154065749 18:11105476-11105498 GTGCTGGGATTCTCACCACGTGG - Intronic
1156570297 18:38244830-38244852 GAGGTGGGTGTCTCATCAGCAGG + Intergenic
1161083069 19:2321130-2321152 GAGCTGGGTGTGTCAGGACCTGG - Intronic
1161757012 19:6141520-6141542 GAGCATGGTTTCTGCACACCTGG + Exonic
1162588918 19:11578273-11578295 GAGCTGTGTTTGACAACATCTGG + Intronic
1168306240 19:55437841-55437863 GGGCTGGGTTTCTGGACTCCTGG - Intronic
925232884 2:2251614-2251636 GTGCTGTGTTTATTAACACCAGG + Intronic
925574978 2:5350946-5350968 GTGCTGTGTTTATAAACACCAGG - Intergenic
925914696 2:8596379-8596401 GACCTGGGTATCTTGACACCCGG + Intergenic
926067579 2:9856103-9856125 GACCTGGGTTTCTCAGTACTGGG - Intronic
927517687 2:23681732-23681754 GGGCTGGGATTCTGAAGACCTGG - Intronic
928056688 2:28063230-28063252 AAGCTGTGTTTCTCATCACGTGG + Intronic
928741376 2:34357570-34357592 GAGCTGAGATTTTCATCACCAGG - Intergenic
933057351 2:77688049-77688071 GAGTTTGGTTTCTCATTACCAGG - Intergenic
933380689 2:81539703-81539725 GAGCAGGGGTCCTCAACTCCCGG - Intergenic
933744338 2:85559866-85559888 AAGCAGGGTTTCTCAACTTCAGG + Intronic
933927491 2:87109245-87109267 GAGTTTGGTTTCTCATTACCAGG - Intergenic
941379269 2:164772364-164772386 GGGCTGTGTTTCTAAATACCTGG - Intronic
943648802 2:190434805-190434827 GAGCAGGGTTCCCCAACCCCTGG + Intronic
946150415 2:217762442-217762464 GGGCAGGGGTTCTCAACCCCAGG - Intergenic
947518073 2:230824177-230824199 GAGCTGGGCTTCTCCCTACCTGG - Intergenic
948335061 2:237201230-237201252 GAGCTAGGATGCTGAACACCTGG + Intergenic
1173758893 20:45542578-45542600 GAGCTGGTTCTGTCAGCACCAGG + Intronic
1174104869 20:48155050-48155072 GACTTGGGGTTCTCAATACCTGG - Intergenic
1174683678 20:52432866-52432888 TAGCTGTGTTTCTCAACAGGAGG + Intergenic
1174739579 20:52998918-52998940 GAGTTGATTTTCTCATCACCTGG - Intronic
1180942663 22:19669675-19669697 GAGCTGGGTTTCACTTCCCCAGG - Intergenic
1183745561 22:39689662-39689684 CCGCTTGGTTTCTCTACACCCGG - Exonic
1185086207 22:48742322-48742344 GAAGCAGGTTTCTCAACACCAGG - Intronic
950154052 3:10708741-10708763 GAGCTCGGCTTTTCAAGACCTGG - Intergenic
950806353 3:15606331-15606353 GAGCTAGGGTTCTCAACTCTGGG - Intronic
954752092 3:52819466-52819488 GACCTGGGGTTCTCAGCTCCAGG - Exonic
957902848 3:86519128-86519150 GAGCTGAGTTTATCAACAAGTGG - Intergenic
957992467 3:87644768-87644790 GAGCAGGGGTTCCCAACACCTGG + Intergenic
959750930 3:109834165-109834187 GAGCTGGGGTTCTCAGCACTTGG + Intergenic
960369232 3:116813217-116813239 CAGCTGGGGCTTTCAACACCTGG + Intronic
961904763 3:130251339-130251361 GAGCTGGGGGTGTTAACACCTGG + Intergenic
963864950 3:150350529-150350551 GAGTTGTGTTTTTCAATACCTGG - Intergenic
967194076 3:187011609-187011631 GAGCTGGGTTCCTTCACACAGGG + Intronic
968228230 3:196989241-196989263 AAGCTGGCTTTCCCAATACCAGG - Intronic
970114146 4:12674459-12674481 GAGCTGAGTCTCTCACCACCTGG + Intergenic
970528143 4:16953800-16953822 GAGCTGGGTTTGTAACAACCAGG - Intergenic
974003836 4:56536163-56536185 GAGCAGGGGTTCCCAACCCCCGG - Intronic
975477873 4:74843875-74843897 GAGCAGGGTTCCCCAACCCCGGG + Intergenic
975503192 4:75110014-75110036 GGGCAGGGTGTCTCATCACCTGG + Intergenic
976650951 4:87434183-87434205 TAGCTGGGATTCACCACACCTGG + Intronic
978075178 4:104519942-104519964 AAGCTGGTTTCCTCAACTCCTGG + Intergenic
979253438 4:118588634-118588656 GAGCTGGGTTTCTGGAAGCCAGG - Intergenic
979934912 4:126680119-126680141 GAAATGGTTTTCTCAACCCCAGG - Intergenic
985080572 4:186260315-186260337 GAGCAGGGGTTCCCAACCCCCGG - Intergenic
985431208 4:189881977-189881999 GAGCTTGGATTTTAAACACCTGG + Intergenic
986214805 5:5709557-5709579 GGGCTGTGTTTCTCTCCACCTGG - Intergenic
990299968 5:54440403-54440425 GAGCTAGGATTCACCACACCCGG - Intergenic
991042585 5:62191341-62191363 AAGATGGGTTTCTCAGCTCCAGG - Intergenic
993010533 5:82477524-82477546 GAGCTGGGCTTCTCATCTCCTGG + Intergenic
994329493 5:98488888-98488910 CAGCAGGGGTTCTCAACCCCTGG - Intergenic
994452262 5:99956969-99956991 GAGGTCTGTTTCTCAACACATGG - Intergenic
996631599 5:125639467-125639489 GAGTTGGGGTGCTCAACACATGG - Intergenic
996770069 5:127076404-127076426 CAGCAGGCTTTCTCTACACCAGG - Intergenic
997785798 5:136712152-136712174 GAGCTGGGTTTTTCACTGCCAGG + Intergenic
998008560 5:138674469-138674491 GATGTGGGTCTCTCAACAACTGG - Intronic
998292224 5:140926622-140926644 GCGCTGCGCTCCTCAACACCCGG + Intronic
999369976 5:151048809-151048831 GGGCTGGGATTCGGAACACCAGG + Intronic
1000017204 5:157288435-157288457 GAGCAGGGTTTGTCAACACAAGG - Intronic
1001031140 5:168264245-168264267 GAGCTGGTATTTTGAACACCTGG + Intergenic
1001225441 5:169940860-169940882 GATCTGGGGTCCCCAACACCTGG - Intronic
1004549685 6:16634967-16634989 GAGCAGGGGTTCCCAACCCCTGG + Intronic
1007100581 6:39243534-39243556 GATTTGGGTGTCTCAGCACCCGG + Intergenic
1008172614 6:48227715-48227737 GACCTGGGATTCACATCACCGGG + Intergenic
1010052694 6:71526503-71526525 GAGCTGGGTTTCTGGAAACAGGG - Intergenic
1010757413 6:79682602-79682624 GAGTTGGGTTTCTCAGTACCTGG + Intronic
1011165730 6:84443882-84443904 GAGCTGGCTTTCTCATTTCCTGG - Intergenic
1011292730 6:85793298-85793320 CAGCTGGGGTTCCCAACCCCTGG + Intergenic
1014809531 6:125870119-125870141 GGGGTGGGGGTCTCAACACCGGG - Intronic
1016388468 6:143551541-143551563 GAGCTGGGTTTCTCAACACCCGG + Intronic
1019773092 7:2896058-2896080 GTGCTGGGTTTGTAAACACCAGG + Intergenic
1025027819 7:55532653-55532675 GAGCTGTATTTTTCCACACCAGG - Intronic
1028765565 7:94554285-94554307 AAACTGGATTTCTCAACACATGG - Intronic
1031809480 7:126347808-126347830 CAGCTCAGTCTCTCAACACCTGG + Intergenic
1032252345 7:130269125-130269147 CAGCTGGGGTTCTGAAAACCTGG + Intronic
1032526606 7:132582560-132582582 TAGCTCAGTTTCTCAACACATGG - Intronic
1035078852 7:156199520-156199542 GAGCTGGGTTTCTCAAAGGGTGG + Intergenic
1036750505 8:11440780-11440802 AAGGTGGTTTTCTCTACACCTGG - Intronic
1037550050 8:19961908-19961930 TAGCTTGGTTGCTGAACACCAGG + Intronic
1047215512 8:122872968-122872990 GACCTGAGTTTCTCAATTCCAGG - Intronic
1048263928 8:132968758-132968780 CAGAGGAGTTTCTCAACACCTGG + Intronic
1050074245 9:1847127-1847149 GAGCTGGGGTCCCCAACCCCTGG - Intergenic
1050367571 9:4886674-4886696 GAGCAGTGTTTCTCAACATGTGG - Intergenic
1051670321 9:19503915-19503937 GTGCTGGGTTTTTCAGCTCCAGG + Intergenic
1051920340 9:22257322-22257344 GAGCTGGTGCTCTGAACACCTGG + Intergenic
1052347960 9:27428917-27428939 AAGCTGGCTTTCCCACCACCTGG + Intronic
1053361106 9:37487091-37487113 GAGCAGGGTTTCTCAACCTCAGG + Intronic
1054934187 9:70669178-70669200 GACCTGGGTGTCTGAAGACCTGG + Intronic
1057907809 9:98995619-98995641 GAGCAGGGTTTCAGAACACAGGG - Intronic
1058211641 9:102177012-102177034 GAGCTGGGTTTCTGATCTCAAGG + Intergenic
1059854464 9:118381038-118381060 GATCTGGTTTTCTCAACCACTGG - Intergenic
1061623129 9:131824509-131824531 GAGCTGGGCTGCTGAACACAGGG + Intergenic
1062267820 9:135695463-135695485 GAGGTGGGGTGCCCAACACCTGG + Intronic
1186104865 X:6194847-6194869 GAGCTGCGTTACTTAACACCTGG - Intronic
1186800976 X:13092313-13092335 GAGCTGGGTTTCCCAAGACTAGG - Intergenic
1187834522 X:23417877-23417899 GAGCTGGGCTTCTCAAACTCTGG + Intergenic
1192930551 X:75801398-75801420 GAGCTGTGTTTCTCAAATGCTGG - Intergenic
1199685799 X:150264086-150264108 GAGAAGGGTTTCTCAAAACCGGG + Intergenic
1199920981 X:152403861-152403883 GATCTTGGTTTTTCAAAACCTGG - Intronic
1201054616 Y:9976164-9976186 GACTTGGATGTCTCAACACCTGG + Intergenic
1201512998 Y:14786203-14786225 GATCTGGGTTTCTCAACCTCAGG - Intronic