ID: 1016391161

View in Genome Browser
Species Human (GRCh38)
Location 6:143577418-143577440
Sequence CAGGAGAGGCTTTGTGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016391158_1016391161 -5 Left 1016391158 6:143577400-143577422 CCTAGCAGTTAAAAAGGTCAGGA 0: 1
1: 0
2: 0
3: 13
4: 216
Right 1016391161 6:143577418-143577440 CAGGAGAGGCTTTGTGAGAAGGG No data
1016391156_1016391161 -4 Left 1016391156 6:143577399-143577421 CCCTAGCAGTTAAAAAGGTCAGG 0: 1
1: 0
2: 0
3: 11
4: 100
Right 1016391161 6:143577418-143577440 CAGGAGAGGCTTTGTGAGAAGGG No data
1016391152_1016391161 28 Left 1016391152 6:143577367-143577389 CCCAGATAACAGTAGAGAAGATG 0: 1
1: 0
2: 3
3: 28
4: 262
Right 1016391161 6:143577418-143577440 CAGGAGAGGCTTTGTGAGAAGGG No data
1016391153_1016391161 27 Left 1016391153 6:143577368-143577390 CCAGATAACAGTAGAGAAGATGA 0: 1
1: 0
2: 0
3: 12
4: 171
Right 1016391161 6:143577418-143577440 CAGGAGAGGCTTTGTGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016391161 Original CRISPR CAGGAGAGGCTTTGTGAGAA GGG Intronic
No off target data available for this crispr