ID: 1016396978

View in Genome Browser
Species Human (GRCh38)
Location 6:143634700-143634722
Sequence CAGGCTGATGACTTTGTAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016396975_1016396978 18 Left 1016396975 6:143634659-143634681 CCAAGATGATAAAAGACAATAGT 0: 1
1: 0
2: 0
3: 21
4: 277
Right 1016396978 6:143634700-143634722 CAGGCTGATGACTTTGTAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016396978 Original CRISPR CAGGCTGATGACTTTGTAGT TGG Intronic
No off target data available for this crispr