ID: 1016397105

View in Genome Browser
Species Human (GRCh38)
Location 6:143636309-143636331
Sequence TGAAATGTATTTTTACATAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 780
Summary {0: 1, 1: 0, 2: 10, 3: 76, 4: 693}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016397105 Original CRISPR TGAAATGTATTTTTACATAA GGG Intronic
901166726 1:7226698-7226720 TGCAATTTTTTTTTAAATAATGG + Intronic
902715136 1:18267509-18267531 AGAAATGTCTTTTTCCATAGTGG - Intronic
902950213 1:19876583-19876605 TCATATGTATTTTTAAATGAGGG - Intergenic
902952838 1:19900531-19900553 TGAAATTTATATTGAAATAAGGG + Intronic
903011728 1:20335948-20335970 TGAACTGTATGTTTAGATCAGGG + Intronic
905814366 1:40937687-40937709 TGAATTGTATATTGACTTAATGG - Intergenic
907461067 1:54606013-54606035 TGAATTGTATTTTGACAAACTGG + Intronic
908499301 1:64727129-64727151 TTATGTGTATTTTTACACAATGG - Intergenic
909097466 1:71305662-71305684 TGCAAAGTTCTTTTACATAATGG + Intergenic
909176090 1:72361144-72361166 TGGAATGTACCTTAACATAAGGG + Intergenic
909262298 1:73506445-73506467 AGAAACTTATTTCTACATAAAGG + Intergenic
909832271 1:80207256-80207278 TGAAATTTATTTTTAATTTATGG + Intergenic
909946824 1:81673152-81673174 TGAAATGAATTTTTAAATGATGG - Intronic
909966316 1:81915247-81915269 TGAAAAGTTTTTTTACAGACAGG + Intronic
910780468 1:90926855-90926877 TGAAATTGCTTTTTAAATAAAGG - Intronic
911795539 1:102071046-102071068 AGAAATGTATTTCTAAAGAAAGG + Intergenic
912283216 1:108339860-108339882 TGATAACCATTTTTACATAAAGG - Intergenic
912729565 1:112090301-112090323 AGAAATGTGATTTTACAAAAAGG + Intergenic
913465966 1:119143143-119143165 TGAAATGTTTTCATACAAAATGG + Intergenic
915350728 1:155223713-155223735 TGAAATTTATTTTTAGAGATGGG + Intergenic
915864877 1:159488591-159488613 TTAAATATACTTTTACATACTGG + Intergenic
916139847 1:161686374-161686396 TCAATTGTATTTCTACATATTGG - Intergenic
916417259 1:164603494-164603516 GGATCTGTATTTTCACATAATGG - Intronic
916440930 1:164823924-164823946 TGAGATGTATTTTTAGATGGTGG + Intronic
916457652 1:164987343-164987365 TGAATTGTATTTTTGCACACCGG + Intergenic
916835547 1:168541277-168541299 TGCCATCTATTTTAACATAAAGG + Intronic
916839056 1:168580873-168580895 TGCCATCTATTTTAACATAAAGG - Intronic
917217731 1:172695453-172695475 GCAGATGTATTTTTATATAAAGG + Intergenic
917701604 1:177587320-177587342 TGAAATTGATTTTTAAATGATGG - Intergenic
917736421 1:177925104-177925126 TGAAATGAAGTCTTACAAAATGG - Intronic
918236740 1:182588410-182588432 AGCAATTTATTTTTTCATAACGG - Intronic
918656748 1:187036203-187036225 TGAAATGTAGCATTACAAAAGGG + Intergenic
918711057 1:187730572-187730594 TCAATTGTATTTTTATATACTGG - Intergenic
918924560 1:190765468-190765490 TGAAATGCAATTTTAGATACTGG - Intergenic
918969236 1:191392922-191392944 TGCAATGTATTTTGAAATCAAGG - Intergenic
918980234 1:191547982-191548004 GGGAATGTATTTTCAAATAAAGG - Intergenic
919061841 1:192643442-192643464 TGATATGTATTGTTATGTAAAGG + Intronic
919135488 1:193503186-193503208 TGAAAAGTAGTTTTACTTAATGG - Intergenic
920236004 1:204505694-204505716 GGAAATGTATTTTTCATTAATGG + Intergenic
921028944 1:211319631-211319653 TCAATTGTATTTTCATATAATGG + Intergenic
921200079 1:212796156-212796178 TGTAGTGCATTTTTACATACAGG + Intronic
921935562 1:220793120-220793142 CAAAATGTTTTTTAACATAATGG - Intronic
923419278 1:233796741-233796763 TGCCATGTCATTTTACATAAGGG - Intergenic
923562739 1:235053898-235053920 TGGGATGTATTTATACAGAAAGG - Intergenic
923683989 1:236141949-236141971 TTAAATTTGTTTTTAAATAAAGG + Intergenic
923834829 1:237599357-237599379 TTAAAGGTATTTTTATATATAGG - Intronic
924010143 1:239655812-239655834 TAATATTTATTTTTACAAAAAGG - Intronic
924524476 1:244834620-244834642 TGAAATGTAGAAGTACATAAAGG + Intergenic
924856889 1:247882898-247882920 TAAAGTGTATTATTACATTAAGG - Intergenic
1063267192 10:4466060-4466082 TTTAATTTTTTTTTACATAAAGG + Intergenic
1063395991 10:5687906-5687928 TGAAATGTATGTTTATTTATTGG + Intronic
1063483549 10:6398345-6398367 TGATATTTATTTTAAAATAAAGG + Intergenic
1063781921 10:9334765-9334787 TGTAATGTATTTTTAAAATAAGG + Intergenic
1064572339 10:16707105-16707127 GAAAATGTATATATACATAATGG - Intronic
1064590690 10:16887644-16887666 TGCCATGCATTTTTCCATAATGG - Intronic
1064646041 10:17460702-17460724 TGAAATTTAGTTTTGCATTATGG - Intergenic
1064931856 10:20637400-20637422 TCAAATGTATTTCTACATGCTGG - Intergenic
1065269606 10:24014205-24014227 AGAAATGTGTTTTTAAATAAAGG + Intronic
1065548834 10:26849898-26849920 TGCAATGTATTTTAAAGTAATGG + Intronic
1065836699 10:29664889-29664911 ATAAGTGTATTTTTACAGAAAGG + Intronic
1066601197 10:37108891-37108913 TTTAATGTTTTTTTAAATAAAGG + Intergenic
1066806905 10:39265666-39265688 TGAAATGTCCATTTGCATAATGG + Intergenic
1067075506 10:43178249-43178271 AAATATGTATATTTACATAAGGG - Intronic
1067257380 10:44655868-44655890 TGAAATACAATTTTAAATAATGG + Intergenic
1067518437 10:46974962-46974984 TGAAATTTATTTTCACATTCTGG - Intronic
1067600576 10:47593567-47593589 AGCAATGTATTTTTATATGATGG - Intergenic
1067643813 10:48076866-48076888 TGAAATTTATTTTCACATTCTGG + Intergenic
1067761582 10:49052067-49052089 AAAAATGTATTTGTGCATAATGG + Intronic
1067820968 10:49529805-49529827 TGCAATGTATTTTCACAAAGGGG + Intronic
1068005438 10:51387793-51387815 TGAAATATATTAGAACATAATGG - Intronic
1068113907 10:52714931-52714953 TTAAATGTATTTTTATTTATAGG - Intergenic
1068270012 10:54709934-54709956 TGTAATATATATATACATAAAGG - Intronic
1068589622 10:58840123-58840145 TCAAATGTATTTAAACAAAATGG + Intergenic
1068642030 10:59419983-59420005 GAAAATGTACTTATACATAATGG + Intergenic
1068781672 10:60925768-60925790 TGACATATAGTTATACATAATGG - Intronic
1068817193 10:61330727-61330749 TGAAAAGTATTTTCACATGTGGG - Intergenic
1068915765 10:62429694-62429716 TGAAACGTATTATTTAATAAGGG + Intronic
1069506926 10:69007685-69007707 TTAAATGTATCTTTCCATTATGG - Intronic
1070234709 10:74611373-74611395 TGAATTGTAATTTTTCACAAAGG + Intronic
1070317240 10:75326146-75326168 TCAATTGTATTTCTACATAGTGG - Intergenic
1070634960 10:78118013-78118035 TGAAATAAAATTTTCCATAAGGG - Intergenic
1070853591 10:79586999-79587021 TGAGATGTAATTTTACAACATGG - Intergenic
1071043501 10:81343139-81343161 TGAAAAATATTTTTAAAGAAAGG - Intergenic
1071199737 10:83206741-83206763 TGAAATGTATATTTATTAAATGG + Intergenic
1071652108 10:87401439-87401461 AGCAATGTATTTTTATATGATGG - Intergenic
1071687652 10:87777519-87777541 TGAAATGCTTTTTTAAAAAAAGG + Intronic
1072861685 10:99012717-99012739 TGATTTGTATTTTGACTTAACGG + Intronic
1073090647 10:100935713-100935735 TGTAATGCCTTTTTACATACAGG - Intronic
1073120537 10:101119945-101119967 TGAAATGTCTTTTTATTTGAAGG + Intronic
1073916137 10:108406277-108406299 AGAAATATATTATTACATGAAGG + Intergenic
1074033599 10:109714602-109714624 TTAATTGTATTTTTATATATTGG - Intergenic
1074073843 10:110101746-110101768 GGAAATGTATTAATACATGATGG + Intronic
1074094254 10:110295547-110295569 AGAAATGTTTTTTTAAAAAATGG + Intronic
1074417604 10:113280883-113280905 TTAAATGTATATTCACCTAATGG - Intergenic
1074552592 10:114458659-114458681 TCAAATATATATTTACATCATGG + Intronic
1074843739 10:117378590-117378612 TGAAATGGATATTTCCATGAAGG - Intergenic
1076916808 10:133426958-133426980 TGAAATGTTTTCTTTGATAAAGG + Intergenic
1076936911 10:133571758-133571780 TGAAATGTTTTCTTTGATAAAGG + Intergenic
1078475772 11:11628577-11628599 TTAAATGTTTTATTACTTAAAGG + Intergenic
1078900034 11:15633342-15633364 TCAAATGTAGTTGTACATATTGG - Intergenic
1079226241 11:18607841-18607863 GGAAATTTATTCTAACATAATGG + Exonic
1079287296 11:19147782-19147804 TGAAATTTATTTTTAAATAAAGG - Intronic
1079623649 11:22588275-22588297 TGAAAAGTATTTTTACTTTTTGG - Intergenic
1080559079 11:33445586-33445608 TGAAAAATAATTTTGCATAATGG + Intergenic
1080598340 11:33796903-33796925 GAAAATGTATGTATACATAACGG + Intergenic
1081455170 11:43214223-43214245 TAAAATGTATTTCTATATGAAGG + Intergenic
1081553952 11:44140186-44140208 TGCAATGAATTTTTTCCTAAAGG + Intronic
1082580663 11:54863811-54863833 TGAAATGTCCTTTCACAGAATGG + Intergenic
1083111465 11:60413160-60413182 TGCAATTTATTTTTATATACTGG + Intronic
1083979517 11:66155296-66155318 TGAAATGTGCTTTTTCAGAAAGG + Intronic
1085153376 11:74270014-74270036 TAAAATGTATTTTTTCCTAAGGG - Intronic
1085266945 11:75242735-75242757 TGAAATATATTCTTAGATGAGGG - Exonic
1085631564 11:78121860-78121882 TGACATACATTTTTACATAAAGG - Intronic
1085847312 11:80080911-80080933 TGAAAAGTATTCTTAGAAAAGGG + Intergenic
1085932455 11:81100462-81100484 TGAAAAGTAGTTTGATATAATGG - Intergenic
1086006175 11:82039620-82039642 TGAAAAGTGTTTTAAAATAAAGG - Intergenic
1086118395 11:83279593-83279615 TGAAATTTAGTTTTCAATAAGGG + Intronic
1087070547 11:94075501-94075523 TGAAGTAGATTTCTACATAATGG + Intronic
1087347242 11:96987449-96987471 TGAAAAGCAATTTTATATAATGG - Intergenic
1087541320 11:99524509-99524531 TGAAATATATTTATACTTATAGG + Intronic
1087662651 11:101005426-101005448 TAAATTCTATTTTTGCATAATGG - Intergenic
1087973072 11:104509712-104509734 TTAGATGCATTTTTACCTAATGG + Intergenic
1088346873 11:108836404-108836426 TGTATTATATTTTTAGATAATGG - Intronic
1088432275 11:109771803-109771825 TAAAATGTATGTATACATAATGG - Intergenic
1089301133 11:117499204-117499226 TAAAATGTATTTTTAAAAAAAGG - Intronic
1090115116 11:123962715-123962737 TGAAATGTCTGTTTAAATATTGG - Intergenic
1090290998 11:125544754-125544776 TGAAATGAATTTGAAAATAAGGG + Intergenic
1090393568 11:126405110-126405132 TGAAATGTATTTTTAGGAAGTGG + Intronic
1090772087 11:129930067-129930089 TTAAATGTGTTTTTACATGAAGG + Intronic
1091128929 11:133127782-133127804 TAAAATGTATTTTTCTAAAAGGG + Intronic
1091607913 12:1972688-1972710 TCAAATTTGTTTTTACATATTGG + Intronic
1092063504 12:5570197-5570219 TGAAATATATTTTGAGTTAATGG - Intronic
1093271808 12:17072070-17072092 TGAAAAGTGTTTTTAAATACTGG - Intergenic
1093349927 12:18086442-18086464 TTAAATGTATTATGACTTAATGG + Intronic
1093375997 12:18428882-18428904 TGTAATTAATTGTTACATAATGG - Intronic
1093519213 12:20028414-20028436 TGAAATGTTTTACTAAATAAAGG - Intergenic
1093615774 12:21222156-21222178 TAAAATATAATTTTATATAATGG + Intronic
1094659985 12:32460169-32460191 TGAAAAGTAGTTTTAAATATTGG - Intronic
1095342442 12:41107391-41107413 TGGAATGTATATATACACAATGG - Intergenic
1095550773 12:43436318-43436340 TGAAAAGTATTTTAAAAGAATGG + Intronic
1095796221 12:46221768-46221790 TAAAATGTATGCTTAAATAATGG + Intronic
1095828418 12:46555404-46555426 TGAAATGTTTTCTTACTTAAAGG - Intergenic
1096255753 12:50061221-50061243 TGAACTGTATTTGTGCAGAAAGG + Intronic
1096354173 12:50926150-50926172 TGTAATGTCTTTTAACATGAGGG - Intronic
1097356143 12:58604102-58604124 TGAAAGGTATTTTTGCATGTAGG - Intronic
1097999730 12:65927152-65927174 TGGATTGTTTTTTTACAAAATGG + Intronic
1098106743 12:67075557-67075579 TGAATTGTCATTTTACTTAAAGG - Intergenic
1098404175 12:70106993-70107015 TGAAGAATATTTTTATATAATGG - Intergenic
1098772512 12:74571310-74571332 TGAAATGGATTTTTAATTAAAGG - Intergenic
1099091206 12:78311573-78311595 TGTCATTTATTTTTACATAAAGG - Intergenic
1099182478 12:79484183-79484205 AGAAATGTATTTTAACAAATTGG + Intergenic
1099197204 12:79631490-79631512 TCAATTGTATTTTTATATAATGG + Intronic
1099200561 12:79671965-79671987 TGAAAAGTATTGTTAGTTAATGG + Intronic
1099284465 12:80699785-80699807 TGAAAGGTATTTCTTAATAAAGG + Intergenic
1099569572 12:84298957-84298979 TGAAATGTATATATATATATAGG - Intergenic
1099593294 12:84623737-84623759 TGTAATATATTTTTATATAAAGG - Intergenic
1100444334 12:94647307-94647329 AGAAATCTATTTTTACATCTAGG - Intronic
1100734888 12:97516203-97516225 GGAATTGTAATTTTACATTATGG + Intergenic
1100948135 12:99811390-99811412 TCAAATATAGTTTTACAAAATGG + Intronic
1102593124 12:113972538-113972560 TGAATTGTATGTTTTAATAAAGG - Intergenic
1102707428 12:114894377-114894399 TGACATTTTTTTTTAAATAATGG - Intergenic
1105269382 13:18857022-18857044 ACAAATGAATTTTTATATAATGG - Intergenic
1105642969 13:22285188-22285210 TGAAATGTAAGTCTACAAAAGGG - Intergenic
1105998436 13:25695240-25695262 TAAAAAGTATTTTTAAATTAAGG - Intronic
1106048889 13:26171959-26171981 TGAAATGGTTTTTGAAATAACGG + Intronic
1106827188 13:33536441-33536463 TGAAATATATTTTCCCATCATGG + Intergenic
1107083178 13:36396838-36396860 TGAAATGTAATTACACACAAAGG + Intergenic
1107391640 13:39971003-39971025 TGAAATTTATTTTCATTTAAAGG + Intergenic
1107584823 13:41833804-41833826 TAAAATGTTCGTTTACATAATGG + Intronic
1107845480 13:44508453-44508475 TGAATTGTTTTTTTAAAAAAAGG + Intronic
1107870360 13:44740850-44740872 TTAATTTTATTTTTACAAAAAGG - Intergenic
1107964923 13:45589499-45589521 TGAAATGTATATTTACCCAGCGG - Intronic
1108005781 13:45944852-45944874 TGGAATGTTTTTTAACATAATGG + Intergenic
1108191556 13:47945500-47945522 TGAAATGTCTATAAACATAATGG + Intronic
1108263604 13:48682039-48682061 TCAGAGGAATTTTTACATAAAGG - Intronic
1108621896 13:52192931-52192953 CTAAAGGTATTTTTACAGAAAGG + Intergenic
1108835308 13:54538897-54538919 TAAACTGAATTTTTATATAAAGG - Intergenic
1109595820 13:64552247-64552269 TGAAAAATATTTTTGTATAAGGG + Intergenic
1109598439 13:64590204-64590226 TGAAAGCTATTATTACATGATGG - Intergenic
1109762714 13:66850675-66850697 TGGAATATATTTTCACATCAAGG - Intronic
1109827186 13:67737237-67737259 TCAAATGTCTTTTTAAAAAATGG - Intergenic
1109862250 13:68215463-68215485 TGAAATACAGTTTTAAATAAAGG + Intergenic
1110221155 13:73075559-73075581 TGATATGTATTTACTCATAATGG + Intronic
1110535275 13:76643912-76643934 TGACATGCATATTTACTTAAAGG - Intergenic
1110761967 13:79240811-79240833 TGAAGTGTTTTTTTAAAAAAAGG + Intergenic
1110795837 13:79637071-79637093 TGAAATGTCTTTTAAAATACTGG - Intergenic
1111000876 13:82179810-82179832 GGAAATGTATTTCTCCATAATGG + Intergenic
1111342502 13:86905619-86905641 AGATAAGTATTTTCACATAAAGG - Intergenic
1111883603 13:93990035-93990057 TGAAATGAATTTTTATATCATGG + Intronic
1112250354 13:97773544-97773566 TGAAATAGATATTTATATAAAGG + Intergenic
1112601823 13:100863539-100863561 TGCCATGTATTTGTTCATAACGG + Intergenic
1112849867 13:103692471-103692493 TTAAATGTATTTTTAGTTTAAGG + Intergenic
1113141379 13:107155317-107155339 TGAAATTTATTTATTGATAATGG - Intergenic
1113277790 13:108752167-108752189 TAAAATGTATTTTTAAATGTGGG + Intronic
1113535209 13:111061062-111061084 TGAAGTGTTTTTTTATTTAAAGG + Intergenic
1114049430 14:18910570-18910592 TTATATATATGTTTACATAAAGG - Intergenic
1114113133 14:19491361-19491383 TTATATATATGTTTACATAAAGG + Intergenic
1114749765 14:25190071-25190093 TGTACTGTCTTTTTAAATAATGG - Intergenic
1114788500 14:25628667-25628689 TGCAATGCAGTTTTACATACAGG - Intergenic
1114847545 14:26341428-26341450 TGAAATTCAATTTTAAATAATGG - Intergenic
1114855943 14:26443648-26443670 ATAGATGTCTTTTTACATAAAGG - Intronic
1114857743 14:26470068-26470090 TAAAAAGTATTTTTAAATATTGG + Intronic
1114860558 14:26514785-26514807 TCATATGTATTTTTAATTAAAGG - Intronic
1115923064 14:38398633-38398655 TTATATGTATTTTAACAGAAGGG + Intergenic
1115925807 14:38432547-38432569 TGGTGTGTATTTTTAAATAATGG - Intergenic
1116014514 14:39390026-39390048 AGAAATATATTTTTAATTAAGGG + Intergenic
1116383489 14:44301484-44301506 TTAAATTTATTTTTACTTTAGGG + Intergenic
1116529702 14:45954808-45954830 TGAAATAGATATTTACAGAAAGG - Intergenic
1116707559 14:48321676-48321698 TGAAATGTAAAATTATATAAAGG - Intergenic
1117020126 14:51561951-51561973 GGAAATGTAGTTTTAGAAAATGG - Intronic
1117156342 14:52945802-52945824 TAAAATGAATTTTTATAGAAAGG + Intronic
1117312073 14:54536489-54536511 GGAAATGTTTTTTTCCAAAAAGG - Intronic
1117581097 14:57152579-57152601 TGAAATGTGTTCTAACATAGGGG + Intergenic
1117595917 14:57327140-57327162 TGGAATAGATTTATACATAAAGG + Intergenic
1117961890 14:61171467-61171489 TGAAATAAATTTGTACTTAATGG - Intergenic
1118014464 14:61644356-61644378 TGAAATAAATTTTCACATAGAGG - Intronic
1118198471 14:63650189-63650211 TTAAATGTATTTTAACAGAGGGG - Intergenic
1118299026 14:64598245-64598267 TGAACTATTTTTTTACAGAAGGG + Intergenic
1118396927 14:65345787-65345809 TAAAATGTACTTTTACAAATGGG + Intergenic
1118541338 14:66829543-66829565 AAAAAGGTATTATTACATAAAGG + Intronic
1119048717 14:71344913-71344935 TGAAATATATCTTTCCATTAAGG - Intronic
1120129670 14:80790516-80790538 TGCAATGGATATTTACATCAGGG - Intronic
1120154053 14:81071866-81071888 TGAAATGTAATATTACTGAAAGG - Intronic
1120489416 14:85157764-85157786 TGAAATGTATTTTTTCTCAAAGG - Intergenic
1120497029 14:85250520-85250542 TGGAATGTCTGTTTACATGATGG + Intergenic
1120614442 14:86685636-86685658 TGAAAAGGATATTTACATACAGG - Intergenic
1120787852 14:88553175-88553197 TGAAATGTATTACTGCATCAGGG + Intronic
1120961383 14:90128224-90128246 TGAAATGTATTCTTTCATTCCGG + Intronic
1121455913 14:94038784-94038806 TGCAGTGTATTTTTATATCAGGG + Intronic
1121465396 14:94112321-94112343 TCATATGTATTTTTGCAGAATGG + Intronic
1121801746 14:96779913-96779935 TGAAATGCTTTTTCCCATAATGG - Intergenic
1122108240 14:99476781-99476803 TGAATTGTATTCTTAAAAAATGG + Intronic
1202829940 14_GL000009v2_random:16987-17009 ACAAATGAATTTTTATATAATGG + Intergenic
1123669293 15:22638714-22638736 TAAAACGTATTTTTCCATTAGGG - Intergenic
1123755884 15:23397362-23397384 TGAAATATGTTTTTATATATTGG + Intergenic
1124174421 15:27408981-27409003 TTAAATGGATTTCTACACAATGG + Intronic
1124525267 15:30445184-30445206 TAAAATGTATTTTTCCATTAGGG - Intergenic
1124701958 15:31922606-31922628 TGAAATGATTTTTGACATAAAGG - Intergenic
1124773388 15:32562527-32562549 TAAAATGTATTTTTCCATTAGGG + Intergenic
1125197379 15:37062784-37062806 TGGAATGTATTTTTAAAAATTGG + Intronic
1125202741 15:37114520-37114542 TGAAATTAATTTTTAAATAAAGG + Intergenic
1125330842 15:38580710-38580732 TGAAACGTATTCTTACATCTTGG - Intergenic
1126058390 15:44754440-44754462 TGAAATGTGTTTTTTTAAAAAGG + Intronic
1127201234 15:56653966-56653988 TGAGATGTTTTCTTACACAAAGG - Intronic
1127464843 15:59233934-59233956 TAAAATCTTTTTTTACATATTGG + Intronic
1128001511 15:64196908-64196930 TAAAATTTATTTTTCAATAAAGG + Intronic
1128599757 15:68986117-68986139 TTTAATGTATATTAACATAATGG + Intronic
1128908647 15:71492110-71492132 TGAGATGTATTTATATATTATGG + Intronic
1128953849 15:71918616-71918638 TGAAAAGTAATTTTTCATACTGG + Intronic
1130164066 15:81434734-81434756 TGAAAGCTATTCTAACATAAGGG + Intergenic
1130757166 15:86777053-86777075 TGAAATTAATTTTTGCATATAGG + Intronic
1131503766 15:92997729-92997751 TCAAATGTACTTTTAAACAAAGG - Intronic
1131701416 15:94940845-94940867 TGAAAAGTATTTTCACCTGAAGG - Intergenic
1133644462 16:7750980-7751002 TGAAATATAGTTTTATATAATGG + Intergenic
1134455037 16:14389059-14389081 CGAAATGTATTTTTACATATTGG + Intergenic
1134460450 16:14425355-14425377 TGAAATATATTTTTATATATTGG - Intergenic
1134614300 16:15638196-15638218 TGTAATATAATTTTATATAAGGG - Intronic
1135938471 16:26800726-26800748 TGAAATGGATTTATGCAAAAAGG - Intergenic
1137300048 16:47140597-47140619 TGAAAAGTCTTATTAAATAATGG - Intronic
1138946860 16:61861976-61861998 TTAAGTGTAGTTTTGCATAATGG + Intronic
1139043681 16:63031198-63031220 TCAAATGTATTCTTATAAAAGGG - Intergenic
1139170038 16:64619043-64619065 TGAAGTCTGTTTTTGCATAAAGG - Intergenic
1140186455 16:72777126-72777148 TGAAATGTGTTTTTTTAAAAAGG + Intergenic
1140563106 16:76007579-76007601 TACAATGTTATTTTACATAAGGG + Intergenic
1140668652 16:77251812-77251834 TGAATTGTGTTTTTAAAAAAAGG - Intronic
1140851633 16:78940062-78940084 TCAAATGCATTTTTGTATAATGG - Intronic
1203012673 16_KI270728v1_random:313356-313378 TGAAATGTCTATTCACAGAATGG - Intergenic
1203031008 16_KI270728v1_random:586515-586537 TGAAATGTCTATTCACAGAATGG - Intergenic
1203040713 16_KI270728v1_random:747916-747938 TGAAATGTCTATTCACAGAATGG + Intergenic
1148577876 17:48724147-48724169 AGATATTTATTTTTACATAAGGG - Intronic
1149045823 17:52244225-52244247 TGAAAAGTATGTTTTCAAAAGGG - Intergenic
1149333900 17:55614659-55614681 TGGAATTTATTTTTGAATAATGG + Intergenic
1149797201 17:59531577-59531599 TAAAATGTAGTTTTACAAGATGG - Intergenic
1149801723 17:59574720-59574742 TGAAATGTCCTTTGAAATAATGG - Intronic
1149844764 17:60000760-60000782 TGAAATGTCCTTTGAAATAATGG + Intergenic
1150057818 17:62035277-62035299 TGAAATAAATTTTTAAATACAGG - Intronic
1151023473 17:70647868-70647890 TAAAATGTGTTTTGATATAAAGG - Intergenic
1203193301 17_KI270729v1_random:209069-209091 TGGAATTTATTCGTACATAATGG + Intergenic
1203202663 17_KI270730v1_random:8499-8521 TGGAATTTATTCGTACATAATGG + Intergenic
1153066554 18:1051737-1051759 TGAAATGCATTTTTACAAGTTGG + Intergenic
1153095425 18:1396134-1396156 TAAAATCTATTTTTTCATTAGGG - Intergenic
1153353406 18:4107500-4107522 TGAAATCCCTTTTTTCATAATGG - Intronic
1153513832 18:5886030-5886052 TAAAATGTATTTTTATATCGTGG + Exonic
1154050720 18:10954459-10954481 TAAATTGTATTTCTACATATTGG - Intronic
1154418656 18:14202969-14202991 ACAAATGAATTTTTATATAATGG + Intergenic
1154477189 18:14773397-14773419 ACAAATGAATTTTTATATAATGG + Intronic
1155134307 18:22972830-22972852 TGAAAGGTAATTTTACTTAAAGG - Intronic
1155662767 18:28271107-28271129 TGAAATATATTTTGAAATCAGGG + Intergenic
1155752548 18:29444976-29444998 TGAAAGGTCATTTTACTTAATGG + Intergenic
1155847319 18:30724881-30724903 TAAGATGTAATTTTACATACTGG + Intergenic
1155905826 18:31450027-31450049 TGAAATGCATTTTAACAATACGG - Intronic
1156138699 18:34078513-34078535 TGAAATGTATTGTTACTTGTGGG - Intronic
1156283209 18:35662411-35662433 TGAAATCTATTTTTAAATTCTGG + Intronic
1156411795 18:36836292-36836314 AAAAATGTTTTTTCACATAATGG + Intronic
1157888837 18:51395208-51395230 TTAAATGTATTCTTTCATCAGGG + Intergenic
1158262717 18:55626754-55626776 TGAAATGTCTTTCCACTTAAAGG + Intronic
1158905023 18:62003403-62003425 TGACATGTATCCTTACAAAAAGG - Intergenic
1159303739 18:66612974-66612996 ATAAATGTGTTTTTACATATGGG - Intergenic
1159444930 18:68530287-68530309 TAAAATGTTTTTGTAGATAAAGG + Intergenic
1159742019 18:72183909-72183931 GGAAATATATTTTTAAATATAGG + Intergenic
1160032668 18:75276661-75276683 GTAAATGTATTTTGATATAATGG + Intronic
1160069930 18:75619561-75619583 TGAAATGGATGTTTTCATACAGG + Intergenic
1160132427 18:76238264-76238286 TGAAATGACATCTTACATAAAGG + Intergenic
1162560140 19:11412661-11412683 TGAATTTTATTTTTAGATACAGG - Intronic
1163456429 19:17408773-17408795 TATAATGTATTTTTATATATTGG + Intronic
1167193279 19:48007143-48007165 TGAAAAGCATTTTCACATCAAGG + Intronic
1202642746 1_KI270706v1_random:110798-110820 ACAAATGAATTTTTATATAATGG - Intergenic
925250167 2:2427267-2427289 TGAATTGTATATTTGCATATCGG + Intergenic
925577334 2:5373788-5373810 TTAAATGTGTTTTTACAAAGAGG + Intergenic
925664159 2:6235582-6235604 TGAAAGATATTTTTACACACAGG - Intergenic
926757520 2:16248216-16248238 TGCAATTTATTTTTAAATTATGG + Intergenic
927609062 2:24518658-24518680 TGAATTGTATTTTTGTATATTGG + Intronic
927703792 2:25284870-25284892 AGAAATGTTTTTTTCCAAAAGGG + Intronic
928117263 2:28555102-28555124 TGAAATGTATTTTTCATTATTGG - Intronic
929433868 2:41911999-41912021 TGGAATGCATTTTTATATATGGG + Intergenic
930153789 2:48084593-48084615 TGATATGTATTTTAGTATAAGGG - Intergenic
930328283 2:49948410-49948432 TAAAATATAGTTTTACAAAAGGG - Intronic
930497401 2:52164005-52164027 GGAAATTTATGTTTACACAAAGG - Intergenic
930683021 2:54277816-54277838 AGTAATATATTATTACATAAAGG - Intronic
930748997 2:54914423-54914445 TGAAATGTAATTTAACCAAATGG + Intronic
932027226 2:68147177-68147199 TGCCATGTATTTGTAAATAAAGG - Intronic
933040030 2:77453006-77453028 TGAAATTAATTTTTTGATAAAGG + Intronic
933078493 2:77958760-77958782 AAAAATGAAATTTTACATAAGGG - Intergenic
933297367 2:80505652-80505674 TGAAATGTCTTTCTCCATATTGG - Intronic
933786282 2:85845166-85845188 TGAAATGTATTTGAATATAATGG + Intronic
934498597 2:94834247-94834269 ACAAATGAATTTTTATATAATGG - Intergenic
934677068 2:96257145-96257167 TGAAATGTTTTTTTAAAGAATGG - Intronic
936498109 2:113040571-113040593 TTAACTGTATTTTTATATACTGG + Intronic
937180572 2:119992230-119992252 TTAAATTTATTTTTTCATAAAGG - Intergenic
937920509 2:127125711-127125733 TGAAAACTATGTTTACACAAAGG - Intergenic
938196435 2:129333150-129333172 TAAAATGTATGTTTACAAAGAGG - Intergenic
938426777 2:131198904-131198926 TTATATATATGTTTACATAAAGG - Intronic
939083534 2:137689050-137689072 CCAAATGTATTTTTACAGCATGG - Intergenic
939317493 2:140570238-140570260 TGAAAAGTCATTTTACAAAAAGG + Intronic
939638220 2:144608654-144608676 TGAAATGTGTTTTTTAAAAAGGG + Intergenic
940163192 2:150737010-150737032 TCAATTATATTTTTACATACTGG + Intergenic
940683647 2:156818865-156818887 TAAAATGTATTTTTACAATAGGG - Intergenic
941404588 2:165073345-165073367 ACAAATGTATTTTTATATACTGG + Intergenic
941474463 2:165932923-165932945 TGAAATATATTTTTTAATATAGG + Intronic
941567219 2:167124463-167124485 TGAATTTTATATTCACATAAAGG - Intronic
941645807 2:168039882-168039904 AGGAATTTATTTTTAGATAAAGG + Intronic
942324992 2:174768995-174769017 GGAAATGTATTTTGACGTGAGGG + Intergenic
942332641 2:174843665-174843687 TGACATTTATTTATACTTAAGGG - Intronic
942339477 2:174928555-174928577 TGAAATGTATGTGCAAATAAGGG + Intronic
942379621 2:175375182-175375204 TTAATTTTATTTGTACATAAGGG + Intergenic
942712776 2:178856077-178856099 TATTATGTATTTTTACATGAAGG + Intronic
942820245 2:180105143-180105165 TGGAAATTATTTTTACATAGAGG + Intergenic
943089976 2:183362740-183362762 AAAAATGTATTTTGCCATAAGGG + Intergenic
943161102 2:184252412-184252434 GAAAATGTATTTATACACAATGG + Intergenic
944325911 2:198403594-198403616 TGAAAAGAATTTTGACTTAATGG - Intronic
945011106 2:205464634-205464656 TGAAATATAATTTTAGAGAAAGG - Intronic
945127366 2:206527446-206527468 TGAAATGTAATTTTTGATGATGG - Intronic
945593237 2:211760570-211760592 AGATATGTACTCTTACATAAAGG + Intronic
947231826 2:227895361-227895383 CTAAATGAATTTTTCCATAAAGG + Intronic
947366864 2:229405588-229405610 ATAAATGTGTTTTTACATCAAGG - Intronic
947386772 2:229598549-229598571 TGTAAGGTAGTTTAACATAAAGG - Intronic
947607854 2:231500831-231500853 AGAAATATATTTTTACATGGAGG - Intergenic
1168959832 20:1861390-1861412 GGAAATGAATTCTTTCATAATGG - Intergenic
1169236955 20:3937468-3937490 TGAATTGTACTGTTACTTAAAGG - Intronic
1170053782 20:12176419-12176441 TGAAATGTTTAGTTATATAAGGG - Intergenic
1170248908 20:14257670-14257692 TAAAATTTATTTTTATATGAAGG + Intronic
1170369040 20:15628241-15628263 TTAAATGTATATGTAAATAAAGG - Intronic
1170996024 20:21359661-21359683 TGAAAATTACTTTTACCTAAGGG - Intronic
1171889862 20:30700978-30701000 ACAAATGAATTTTTATATAATGG - Intergenic
1171922844 20:31164930-31164952 TGTAATGGATTCTTACAGAATGG + Intergenic
1172332618 20:34086008-34086030 TAAAATGTATTTTGAGATCAGGG + Intronic
1173493748 20:43504228-43504250 AGAAGTGTTTTTATACATAAAGG + Intergenic
1174646007 20:52086124-52086146 GGAAATATTTTTTTACTTAAAGG - Intronic
1175682441 20:60999737-60999759 TGAAATTTTTTTTTACTAAAGGG + Intergenic
1176609127 21:8861827-8861849 ACAAATGAATTTTTATATAATGG + Intergenic
1176854642 21:13956321-13956343 ACAAATGAATTTTTATATAATGG - Intergenic
1177428853 21:20962765-20962787 TGAAATGAATTTGTACATAAAGG + Intergenic
1177503270 21:21986885-21986907 TAAAATGTATTTTTCCATATTGG + Intergenic
1177729623 21:25011545-25011567 TGAAATGGAATTGTACATGAAGG + Intergenic
1178468846 21:32873727-32873749 TGAAATATATTTCTATATACAGG + Intergenic
1180359219 22:11871658-11871680 ACAAATGAATTTTTATATAATGG + Intergenic
1180467913 22:15632947-15632969 TTATATATATGTTTACATAAAGG - Intergenic
1180559494 22:16603084-16603106 AGAAATGTCTTCTTACAGAACGG + Intergenic
1181425116 22:22831027-22831049 TGAAATTTATTTTTAAAAATTGG - Intronic
1181711145 22:24690815-24690837 TGATTTGTATTTTGACTTAATGG - Intergenic
1184373894 22:44099655-44099677 TCAAATGTATTTATAAATAGTGG + Intronic
1185279501 22:49964054-49964076 TAAAATGTTTTTGTACATAGTGG + Exonic
949315889 3:2754599-2754621 TGAAAAGTATTTTTAAAAAATGG + Intronic
949714485 3:6913482-6913504 TGGTAAGTATTTTCACATAACGG - Intronic
950249633 3:11453668-11453690 TGAATTGTCTGTTTTCATAAGGG - Intronic
950323954 3:12087445-12087467 TAAAATGTATTTTGAAATCAAGG - Intronic
950588580 3:13917183-13917205 TGATGTGTATTTTTATATATTGG - Intergenic
951018844 3:17760363-17760385 TGATATGGATTGTTAGATAAGGG - Intronic
951407646 3:22320358-22320380 TGCAATTAATTCTTACATAAAGG + Intronic
952341871 3:32454078-32454100 GGAAATGTATTTTTAAAAAATGG + Intronic
952352695 3:32555797-32555819 TGAAATGCATTTTTAAAAAATGG + Intronic
952874315 3:37930264-37930286 TTAAATTTATTTTTAGATACAGG + Intronic
952927538 3:38331997-38332019 AGACATTTATTTTTACATAGAGG + Intergenic
953109803 3:39922917-39922939 TGAAATATATTTTTTAATCATGG - Intronic
953296265 3:41720690-41720712 TGACATCTATTTTTACCTCATGG + Intronic
955020881 3:55119954-55119976 TAAAATGTTTTTTCACTTAATGG + Intergenic
955234389 3:57126657-57126679 TGAAATGCATTTTTCCAAAATGG - Intronic
955734384 3:62021505-62021527 TGTATTGTATTTTAACAAAAAGG - Intronic
955863022 3:63352634-63352656 TGAAATGGACTAATACATAAAGG - Intronic
955869355 3:63420529-63420551 TGGAGTTTATTTTTGCATAAGGG - Intronic
956877224 3:73475694-73475716 TGAAATGAACTTTTACCTAGGGG + Intronic
957229599 3:77494705-77494727 TGAAATGAATGTTTACATTTAGG - Intronic
957375813 3:79355767-79355789 TGTGATGTATATATACATAATGG - Intronic
957379652 3:79410216-79410238 TGGTATGTATTTTCACGTAATGG + Intronic
957464455 3:80569332-80569354 TGTAATCTATTTTTCCACAAGGG + Intergenic
957627777 3:82676963-82676985 CCAAATCTATTTTTCCATAAGGG + Intergenic
957813820 3:85264820-85264842 TGTAATTTAATTTTAAATAATGG + Intronic
958178929 3:90032520-90032542 TGAAAACTATTTTTACTAAAAGG + Intergenic
958267935 3:91461762-91461784 AAAAATGTATTTTTAAATAAAGG + Intergenic
958507693 3:95001909-95001931 TTAAATGAAATTTTGCATAATGG + Intergenic
958628859 3:96662491-96662513 TGAAATGGTTTTTTAAATCAAGG - Intergenic
958641320 3:96810838-96810860 TGAAATTTTTTATTAAATAAAGG - Intergenic
958683540 3:97362076-97362098 TGAAATGTATATTTTGGTAAAGG + Intronic
958745117 3:98124870-98124892 TAAAATATATTTTTATATCATGG - Intergenic
958782417 3:98558556-98558578 AGAAATGTATTTTGACATAAGGG - Intronic
959141220 3:102488806-102488828 TGAATGCTATTTGTACATAAAGG + Intergenic
959399130 3:105877834-105877856 TAAAATATATATATACATAAAGG + Intergenic
959662515 3:108884928-108884950 TGAAATGTATTTTTGCCTAAAGG + Intergenic
959688643 3:109175334-109175356 TGAAATTTACATTTACATCAGGG + Intergenic
960111368 3:113848907-113848929 TGAAATGAAATTTAAAATAATGG + Intronic
960526035 3:118711366-118711388 ATAAATGAATTATTACATAAAGG + Intergenic
960813577 3:121650022-121650044 TCAATTGTATTTTTACATACTGG + Intronic
961053317 3:123766112-123766134 TGAAATAGATTTTTATATATTGG - Intronic
961242245 3:125421288-125421310 TGTAATTTTTTTTTACAAAAGGG - Intergenic
961533395 3:127554304-127554326 TGTCATGTGTTTTTGCATAAAGG + Intergenic
961594161 3:128003941-128003963 AGAAATGTATTTTTATAAACTGG + Intergenic
963008234 3:140746360-140746382 TGAAATTTATTTTTAAATGAAGG + Intergenic
963705812 3:148687089-148687111 TGATATGGATTTTAATATAAAGG - Intergenic
963751417 3:149183579-149183601 TCAAATGCATTTTTAGATAAGGG - Exonic
964617606 3:158685376-158685398 ACTAATGTATTTTCACATAAAGG - Intronic
964661550 3:159125612-159125634 TGAAATTTATTTTTTTAAAAAGG + Intronic
965143858 3:164872553-164872575 TGAATTATATTCTTTCATAAGGG - Intergenic
965211680 3:165797566-165797588 TCAAATGTACTTTCAAATAATGG + Intronic
965744555 3:171910933-171910955 TCAACTGTATTTTTACACACTGG - Intronic
965750565 3:171970979-171971001 TGATATGAATTTTTCCATCATGG + Intergenic
965856261 3:173091663-173091685 TGAAATGTATTAATAAATGAAGG + Intronic
965956965 3:174382307-174382329 CTAAATTTATTTTTACAAAAGGG - Intergenic
965966212 3:174493513-174493535 AGAAATTTATTTTCTCATAATGG - Intronic
966754684 3:183357819-183357841 TGAAAAATATCTTTACATCATGG - Intronic
967061728 3:185878781-185878803 AGAAATATATTTTTACATTGTGG - Intergenic
967088270 3:186113274-186113296 TGAAATGTGTTTTTATTTAAGGG + Intronic
967373768 3:188777997-188778019 TGAATTGTAACTTTAAATAAGGG + Intronic
967424116 3:189306554-189306576 TGAAATGTAATTTTAAAAAAGGG - Intronic
967597095 3:191339001-191339023 TTAAATTTATTTTTAGATAAAGG + Intronic
967670545 3:192229275-192229297 TAAAATGTTTATTTATATAATGG + Intronic
967673498 3:192268308-192268330 TTAAATCTAGTTTTAGATAAAGG - Intronic
967722409 3:192829343-192829365 TGGAATTTATTTCTACACAAAGG - Intronic
970467153 4:16335967-16335989 TGAAATGTATCTATACAATAAGG - Intergenic
970558061 4:17255786-17255808 TGAATTGAATTGTTACAAAAAGG + Intergenic
970817402 4:20173699-20173721 TGAAAAGCATTTTTAGTTAAAGG - Intergenic
971128428 4:23779424-23779446 TGAAATGTATTGTTAGAATATGG - Intronic
971626981 4:28933810-28933832 TGAAATGTCTTTTGTCATGAGGG + Intergenic
971665832 4:29483125-29483147 AGAATTGTATTTTTATATACTGG - Intergenic
972020828 4:34311309-34311331 TGAAATGAATTTATACATGCAGG - Intergenic
972185513 4:36522997-36523019 AAAATTATATTTTTACATAATGG - Intergenic
972678324 4:41281635-41281657 TCAAATCTATCTTAACATAAGGG + Intergenic
972753465 4:42017738-42017760 TTAAATGCATTTTTAAATTAAGG - Intronic
972833243 4:42837869-42837891 TGAAATGTATTTTGCCAGAGCGG - Intergenic
973315223 4:48752786-48752808 TCAAAAGTATGTTTACAAAAGGG + Intronic
973582288 4:52356274-52356296 TAAAATGTATCTTTAAAAAAAGG + Intergenic
973841664 4:54867417-54867439 TAAAATGTATATTTAAACAAAGG - Intergenic
974552857 4:63402421-63402443 TGAAATTTATATTTAAATCAAGG - Intergenic
974650036 4:64743324-64743346 GGAAATGTAATTGTACAAAATGG + Intergenic
974991777 4:69101275-69101297 TAAAATATATTTTTTCATCATGG - Intronic
975376924 4:73657133-73657155 TGAAGTTTATTTTTACAAAAAGG + Intergenic
975875599 4:78832847-78832869 TGCAATGTAATTTGAAATAAGGG - Intronic
976402366 4:84621770-84621792 TGAAAAGTTTTTTTAAATGAAGG - Intronic
976798661 4:88962957-88962979 TAAAATGCATTTTTACATATAGG - Intronic
976944935 4:90753359-90753381 TAAAATTTATTTTTACCTGAAGG - Intronic
977187408 4:93957081-93957103 TGAAATGACTTTGTACATTAAGG - Intergenic
977258974 4:94774892-94774914 TGATCTTTATTTTTTCATAATGG + Intronic
977267883 4:94877552-94877574 TAAAATGTATTTCTAGAGAAAGG - Intronic
977372450 4:96156552-96156574 TGAATGGTGTTTTTACAAAAAGG + Intergenic
977692463 4:99929551-99929573 TGAAGTGTATTTTGAGATACAGG - Intronic
978056969 4:104282087-104282109 TGAAATTTATTTTTAAAAAAGGG - Intergenic
978107246 4:104917901-104917923 GTAAATTTATTTTTAAATAAAGG + Intergenic
978832351 4:113103459-113103481 AGAAATGTATTTTGAAATTAAGG + Intronic
978951467 4:114564482-114564504 TGAAAAATATATGTACATAATGG - Intergenic
979015050 4:115421626-115421648 TCAAATGTATTTTTAAGAAAAGG + Intergenic
979029139 4:115618164-115618186 CGAAATGTAATTCCACATAATGG - Intergenic
979124116 4:116945791-116945813 TAAAATATGTTTTTACATATTGG - Intergenic
979394602 4:120171472-120171494 TGAAATCTATTTTAACTTCAAGG + Intergenic
979704247 4:123702240-123702262 TGTAATGTAATTTTTAATAATGG - Intergenic
979834413 4:125345238-125345260 TGCAATGTAATTTTTCATATGGG + Intronic
979910078 4:126353879-126353901 TGTAATGTTTTTTGACAAAAAGG + Intergenic
980429087 4:132667148-132667170 TGAAGTGGATTAATACATAATGG + Intergenic
980695238 4:136346548-136346570 TGAAATGCATTGTTTCATCATGG + Intergenic
980855763 4:138437708-138437730 AGAAATGTCTTTATACAAAATGG + Intergenic
981020355 4:140021379-140021401 TGATATTTGTTCTTACATAAAGG - Intronic
981206841 4:142052138-142052160 TGAAAGGTATTTAAATATAATGG - Intronic
981904129 4:149901166-149901188 TGAAATAAATTTTTAAAAAAAGG + Intergenic
981998281 4:150998779-150998801 TTACATGTATTTATACATACAGG - Intronic
982149789 4:152440557-152440579 TGAAATTTTGTTTTACATCAAGG + Intronic
982700123 4:158651476-158651498 TGAAAAATATTTCTACCTAAAGG + Intronic
982842394 4:160207006-160207028 TTAAATGAATTATTACACAAGGG + Intergenic
982857369 4:160401094-160401116 TCAAATGTATTTTCACATAATGG - Intergenic
982887832 4:160805596-160805618 TGAAATGAGTTTTTAGTTAAGGG - Intergenic
982911363 4:161147057-161147079 TAAAATGTATTTTAAAGTAATGG + Intergenic
983167430 4:164495419-164495441 TGGAATATATTTATACCTAAAGG + Intergenic
983169039 4:164515017-164515039 AGACATGTGTATTTACATAAGGG + Intergenic
983188738 4:164731355-164731377 TAAAATTTATTTTTCCAGAATGG - Intergenic
983810901 4:172060892-172060914 TGTAATTTTTATTTACATAATGG - Intronic
984031014 4:174604144-174604166 TGAAAGCTATTTATACATTAAGG + Intergenic
984113797 4:175652615-175652637 TGAAATGTATTTTTAAAGCTTGG - Intronic
984234918 4:177144378-177144400 TGAAATTTATTTTTATATTCTGG - Intergenic
984305173 4:177980012-177980034 TGTTATGTATCTTTACAAAAAGG - Intronic
984460022 4:180022718-180022740 TGAAATATATTTTTGCTGAATGG - Intergenic
1202770119 4_GL000008v2_random:196697-196719 ACAAATGAATTTTTATATAATGG - Intergenic
986087556 5:4466837-4466859 TGAGATATATTTTGTCATAATGG - Intergenic
986209070 5:5653083-5653105 CAAAATGTATTATGACATAAAGG + Intergenic
986482894 5:8206408-8206430 TGAAATGGGTTTTTAAATAGAGG + Intergenic
986568606 5:9141946-9141968 TAAAATGTATTCTTACACATGGG + Intronic
986931954 5:12835982-12836004 TGGAATATATTTTGAAATAAAGG + Intergenic
986938915 5:12925674-12925696 TGGAAAGTTTTCTTACATAAGGG - Intergenic
987207432 5:15641873-15641895 TAAAATGTATTATAACATGAAGG - Intronic
987729259 5:21747239-21747261 TGATATGGTTTTTTGCATAATGG - Intergenic
987756746 5:22106372-22106394 TGGAATGTATCTTGACATACAGG + Intronic
987948100 5:24640631-24640653 TGAAAGGCATTTTTATATGAAGG + Intronic
988127761 5:27063647-27063669 TGAAGTGTATTTTCACACAGGGG - Intronic
988263666 5:28924776-28924798 GGAAATGTAGTTTTACACACAGG + Intergenic
988354996 5:30162233-30162255 TGAGATGTAGTTTGACCTAATGG + Intergenic
988386486 5:30572813-30572835 TGAAATATATTTATACACATAGG - Intergenic
989016791 5:36945160-36945182 AAAAATTTATTTTTACATAGAGG - Intronic
989171939 5:38480075-38480097 TGTAATGTATTTGCAAATAATGG - Exonic
989270774 5:39530403-39530425 TAAAATGTGCTTTCACATAAAGG - Intergenic
989376071 5:40762460-40762482 TGAAATATTAATTTACATAAAGG - Intronic
989657918 5:43764311-43764333 TGACATATAGTTTTTCATAATGG + Intergenic
990533433 5:56696405-56696427 TGACATCTATTTTTACTTATTGG + Intergenic
990563564 5:57006992-57007014 TGAAATTTATTGTTAAATGAAGG + Intergenic
990839780 5:60064418-60064440 TGAGATGTAGTTATACAAAAAGG - Intronic
991114101 5:62934266-62934288 TGATAGTTATTTTTAAATAATGG - Intergenic
991268292 5:64748441-64748463 TGAATTGTATATTTAAAAAATGG + Intronic
991354604 5:65754777-65754799 TCAAAGGTGTTTTTACACAATGG - Intronic
991360237 5:65812233-65812255 TGAAATGTATCTTTTTTTAAAGG + Exonic
991552177 5:67850870-67850892 TTAAATATAATTTTACATATAGG + Intergenic
991620201 5:68537142-68537164 TTAAATGTATTTTTAAATAAAGG + Intergenic
992204460 5:74417396-74417418 CAAAATGTATTTTAAGATAAAGG - Intergenic
992550987 5:77859799-77859821 TGAAAAGTCTTTTTAAATTATGG - Intronic
992551885 5:77866854-77866876 TGTAAGGTGTTTTTACATAATGG - Intronic
994032027 5:95154033-95154055 TAAAATGTATTTTATCATAAAGG - Intronic
994076186 5:95652495-95652517 TGAATGGTATTTTTGCAGAATGG - Intronic
994106650 5:95957260-95957282 TAAAATGTATTTTTAAATGTTGG + Intronic
994144514 5:96378861-96378883 GTATATGTATTTTTACCTAATGG + Intergenic
994169628 5:96644204-96644226 TGAAGTATTTTTTTAAATAATGG - Intronic
994174218 5:96693262-96693284 CGAAATGTTTTTTAACTTAACGG - Intronic
994181335 5:96769931-96769953 TGTCATGTATATATACATAATGG - Intronic
994281792 5:97913010-97913032 AGAAATTTATTTTTAAATTAGGG - Intergenic
994325957 5:98444966-98444988 TAATATGCAATTTTACATAAGGG - Intergenic
994596195 5:101839284-101839306 TCAAATGTATTTTGATATAATGG - Intergenic
994679509 5:102867927-102867949 AGAGATGTATTTTGAAATAATGG + Intronic
995076233 5:107987320-107987342 TGAAATTTCTTTTTACAAAAAGG - Intronic
995193085 5:109340528-109340550 TGAACTCTGTTTTTGCATAAAGG - Intronic
995293701 5:110491913-110491935 TGAAATTTATTGATATATAATGG - Intronic
995325066 5:110880995-110881017 TGAAGTGTATTTGAAAATAAGGG + Intergenic
996173473 5:120325131-120325153 AGAAATGTATATATACACAATGG + Intergenic
996200088 5:120661816-120661838 TGAAATGTGTTTTAAAACAATGG - Intronic
996597729 5:125224994-125225016 TTAAATGTAAGTTTACATAATGG + Intergenic
996901298 5:128544645-128544667 TGAATTGTTTTTTTCCAGAAAGG - Intronic
996913608 5:128683865-128683887 GAGAATGCATTTTTACATAATGG - Intronic
996961717 5:129258283-129258305 TCAATTGTATTTCTACATAGTGG - Intergenic
998656285 5:144183506-144183528 TGAAAATTATTTTTAAATATGGG - Intronic
999034986 5:148338232-148338254 AAAAATCTATTTTTACATTAAGG + Intronic
999595371 5:153197953-153197975 TGAAATATATCTTTATATATAGG - Intergenic
1000625369 5:163532334-163532356 TGAAATGTAACTTGACATAAGGG - Intergenic
1000694700 5:164366158-164366180 TGAAAGATATTTTCACATGATGG + Intergenic
1000712038 5:164592142-164592164 TGTAATATATTTTTGCCTAAAGG + Intergenic
1000739034 5:164941823-164941845 ATAAATTTATTTTTACATGAAGG + Intergenic
1000767882 5:165314902-165314924 TGAAATGTATTTATACAGAAAGG + Intergenic
1001321079 5:170682093-170682115 TGAAATGCATTTGTAGACAAAGG + Intronic
1003798563 6:9634554-9634576 ATAAATGTATTTTTCAATAAAGG + Intronic
1003923032 6:10851208-10851230 TGTAATGTATTTTTAAAAATTGG - Intronic
1004697226 6:18044782-18044804 TAAAATGTTGTTTTACAAAAAGG + Intergenic
1004756080 6:18611830-18611852 TGAAATATATTTATACAAATAGG - Intergenic
1005144965 6:22679188-22679210 TGACATGTTTTTATATATAATGG - Intergenic
1005162010 6:22875188-22875210 TGAAATATTTTTTTAAATAGTGG - Intergenic
1005590790 6:27324294-27324316 TGAAATGTATTTATAGAATATGG - Intergenic
1006943520 6:37768775-37768797 TCAAAGGTGTTTTTAAATAAAGG + Intergenic
1007461112 6:42019743-42019765 TGTAATGTGTTTTTACAATAAGG + Intronic
1008022419 6:46595367-46595389 TAAAATGTATATATACATAATGG + Intronic
1008371752 6:50740154-50740176 TGAATTTTATTTTCACATATAGG - Intronic
1008646539 6:53520093-53520115 AGAAATGTATTTTTACATAGAGG + Intronic
1008971279 6:57371670-57371692 TGAAATATATTTTTATATTTAGG + Intronic
1008987270 6:57559816-57559838 AAAAATGTATTTTTAAATAAAGG - Intronic
1009175229 6:60452368-60452390 AAAAATGTATTTTTAAATAAAGG - Intergenic
1009284501 6:61799545-61799567 TGAAAAGTAATTTTCCAAAAGGG - Intronic
1009328662 6:62386429-62386451 TGAAATGTTTTCTTAAATGAAGG + Intergenic
1009551258 6:65095506-65095528 TTTAATGTATTTATATATAATGG - Intronic
1009948043 6:70362997-70363019 TGAAGTGTTTTTTTCCGTAAAGG + Intergenic
1010034274 6:71304621-71304643 TGAAATGTTTTTACTCATAAGGG - Exonic
1010354465 6:74915257-74915279 TAAAAGTTATTTTTAGATAATGG + Intergenic
1010378194 6:75199005-75199027 TGAAATGGATTTCTATATCATGG - Intronic
1010564056 6:77386555-77386577 TGAAAATAATTTTTATATAAAGG - Intergenic
1010809813 6:80288548-80288570 TGAAATGTATATTTAAAATAAGG + Intronic
1010845988 6:80708458-80708480 TAAAATATATTGTTGCATAAAGG + Intergenic
1010850877 6:80774941-80774963 TTAAATTTAGTTTTACAGAAGGG + Intergenic
1010886269 6:81245647-81245669 TAAAATTTATTTTTATATAGTGG - Intergenic
1011025067 6:82859471-82859493 TGAAATGTATTCAAACATTATGG - Intergenic
1012187374 6:96235990-96236012 TGAAATGTATTTTCAATGAATGG + Intergenic
1012257564 6:97051233-97051255 TTGAATGGATTTTTACACAAGGG - Intronic
1012299397 6:97565793-97565815 TTACATATATTTTTACAGAAAGG + Intergenic
1012959929 6:105611605-105611627 TGAAATGTTTATTTTCATAATGG - Intergenic
1013065495 6:106680915-106680937 CGAAATGTATATCTACACAATGG + Intergenic
1013066190 6:106686444-106686466 TGCAATGTATGTTTTCATATGGG - Intergenic
1013251717 6:108340940-108340962 TGAAATGTAGTTTTGCTTAATGG + Intronic
1013333087 6:109125942-109125964 TAATATGTACTTTTACATACAGG - Intronic
1013689363 6:112621997-112622019 TGAAATGTATTTATATATTTAGG - Intergenic
1013945278 6:115715490-115715512 TGTGATGAATTTCTACATAAAGG - Intergenic
1014236204 6:118958160-118958182 TCAAATTGATTTTTACATATAGG - Intergenic
1014562593 6:122909145-122909167 TGACATGTAATTTAAAATAAAGG + Intergenic
1014629914 6:123775510-123775532 TGGAGTGTTATTTTACATAAGGG - Intergenic
1014775227 6:125501402-125501424 TAAAATGTATATTTACATTATGG - Intergenic
1014870551 6:126591014-126591036 TTAAATTTAAGTTTACATAACGG - Intergenic
1015184381 6:130397468-130397490 TGAAAAGGATTTTTACATCATGG - Intronic
1015203763 6:130612349-130612371 TACAATGTATTTTAACAGAAAGG + Intergenic
1015379977 6:132555906-132555928 TGTAATCTATTTCTACATCAGGG - Intergenic
1015404542 6:132822276-132822298 TAAAATATATGTTTACTTAATGG + Intergenic
1015845640 6:137517804-137517826 TCACATTTATTTTAACATAAAGG - Intergenic
1015943100 6:138471542-138471564 TGAAAGGTATTTTCACATATTGG - Intronic
1016397105 6:143636309-143636331 TGAAATGTATTTTTACATAAGGG + Intronic
1016497637 6:144682344-144682366 GAAAATGTATTTATACAAAATGG - Intronic
1016851314 6:148622019-148622041 AGAAATATATTTATACATATAGG + Intergenic
1017346949 6:153394761-153394783 TGAAATGAATTGTTAAATCAAGG - Intergenic
1017452742 6:154569390-154569412 TGAAATGTATTTTAAAATGATGG - Intergenic
1017882964 6:158574144-158574166 TAAAATATCTTTTTCCATAAGGG + Intronic
1020410202 7:7883772-7883794 ATGAATGTATTTCTACATAATGG + Intronic
1020587194 7:10083794-10083816 TGTAATGTGTTGTGACATAATGG - Intergenic
1020701916 7:11495227-11495249 TGTTACGTATTTTTAAATAAAGG - Intronic
1020909857 7:14115496-14115518 TCACATGAATTTTTACAGAAAGG + Intergenic
1021026921 7:15679933-15679955 TGCACTGTATTTTTAAATATTGG - Intronic
1021119213 7:16778957-16778979 ATAAATGTATTTTGAAATAAAGG + Intronic
1021249568 7:18307402-18307424 GGAAATGAATTTTTTTATAATGG - Intronic
1021279612 7:18701487-18701509 TAACATGTATTTTCAGATAAAGG + Intronic
1022601108 7:31760846-31760868 TTAAATGTTATTTTACATGAAGG + Intronic
1023493577 7:40769983-40770005 TCAAATGCATATTTAAATAAAGG - Intronic
1024487777 7:49938892-49938914 TAAAATGTATTTTTCCAAATTGG + Intronic
1024832252 7:53474410-53474432 TGAAAAGGAGTTTTATATAACGG - Intergenic
1024841714 7:53594534-53594556 TGAAATGTATTCATGAATAAAGG - Intergenic
1024876202 7:54026694-54026716 AGAAATGTATTTTAAAATAAGGG + Intergenic
1026420600 7:70233087-70233109 TGAAATATGTTTTTAAAGAAAGG - Intronic
1026527679 7:71169514-71169536 TGAATTGAATTTTTACATAATGG + Intronic
1027201604 7:76067394-76067416 GGAAATGGATTTTATCATAAAGG + Exonic
1027308444 7:76927470-76927492 GGAAATATATTTTAAAATAATGG - Intergenic
1027454792 7:78375995-78376017 TCAAATGCATTTTTGAATAAAGG - Intronic
1027688506 7:81309782-81309804 TAAAAGGCATTATTACATAATGG + Intergenic
1027804898 7:82806051-82806073 TTAAATGTGTTTTTCCCTAAAGG - Intronic
1027856333 7:83516189-83516211 TAATATGTATTTTTATATACTGG + Intronic
1027936786 7:84615960-84615982 TTAAATTTATTTTTTAATAAAGG - Intergenic
1027999329 7:85471026-85471048 GGAAATGCATTTTTACCTAATGG - Intergenic
1028651445 7:93154620-93154642 TGAAATGTCTTCCTATATAATGG + Intergenic
1028820098 7:95199199-95199221 TGAAATGTACATTGATATAATGG + Intronic
1028830166 7:95318896-95318918 TGAAATGCCTTTTTACATGCAGG - Intronic
1028937102 7:96477546-96477568 TAATATTTATTCTTACATAATGG - Intergenic
1028995656 7:97097204-97097226 TGAAATGTATATTTCATTAATGG + Intergenic
1029799521 7:102931619-102931641 TGAACTGTATTTATATTTAATGG - Intronic
1030344913 7:108422583-108422605 TAAAATGTATCTTTATGTAAAGG - Intronic
1030819023 7:114074055-114074077 GGTAATTTATTTTTAGATAAAGG - Intronic
1031177694 7:118373443-118373465 GTAAATCTATTTTTTCATAAAGG - Intergenic
1031234929 7:119162863-119162885 TGATATGTATATATACACAATGG - Intergenic
1031321927 7:120341007-120341029 TGAATTGTATTTGTGCATAAGGG + Intronic
1031636477 7:124107236-124107258 TGCTATGTAATTTTATATAAGGG - Intergenic
1032683156 7:134206213-134206235 TGATATGTATTTTAAATTAAGGG - Intronic
1033031017 7:137826893-137826915 TGAAACTCATTTTTACATAAAGG - Intronic
1033830367 7:145244267-145244289 TAAAATGTATTCTTATATATTGG - Intergenic
1034051958 7:147993379-147993401 ACAAATGAATTTTTCCATAAAGG - Intronic
1034142636 7:148836542-148836564 TGAAAAGAATTTTTACCTCATGG + Intronic
1034388062 7:150757153-150757175 AGTAATATATTTTTAAATAATGG - Intergenic
1034617742 7:152434737-152434759 AGAAATGTCTTCTTACAGAACGG - Intronic
1034644888 7:152636743-152636765 TAAAAAGTATTCATACATAAGGG - Intergenic
1034698932 7:153080197-153080219 TGAAATGCATTTATATATCAGGG + Intergenic
1034934722 7:155191387-155191409 TGAAATGTAGTTTTAAAGACTGG - Intergenic
1035012542 7:155732369-155732391 TAAAATGTACTTTTAGAGAAAGG - Intronic
1035099638 7:156385877-156385899 TGAAATGTCTCTTTAGAGAAAGG + Intergenic
1035596810 8:864931-864953 TTAAATGTATTCTTAGATATAGG + Intergenic
1035862240 8:3041906-3041928 TAAAATGTCTTTTGACATCACGG + Intronic
1035962196 8:4149423-4149445 TGAACGGTATTTCTACATAAGGG + Intronic
1036514602 8:9432189-9432211 TGACCTGCATTTTTACAAAATGG + Intergenic
1036964644 8:13283036-13283058 TGAAAAGCAGTTTTAGATAATGG + Intronic
1037241038 8:16777921-16777943 AGAAATTTATTTTTCCAGAAAGG + Intergenic
1039175654 8:34801689-34801711 TGAAATCTATTTTGACAATATGG + Intergenic
1039733302 8:40303468-40303490 AGCAATGTATTTTAATATAATGG - Intergenic
1039802437 8:40970955-40970977 TGATATGTATTCTTTCATCATGG - Intergenic
1039980210 8:42403193-42403215 TGAAATCTATAGTTACAAAATGG + Intronic
1040088992 8:43376745-43376767 TGAAAAGTATTTTTTTTTAAAGG + Intergenic
1040665114 8:49622169-49622191 TGAAGTGCATTTGTAAATAAGGG + Intergenic
1041537048 8:58938293-58938315 TGAAATGTGTTTTTTAATATTGG + Intronic
1042784464 8:72532880-72532902 TTAAATTTATTTTTTTATAAGGG - Intergenic
1042806432 8:72775536-72775558 TAAAATATATATTTACTTAAAGG - Intronic
1042996906 8:74710654-74710676 TGAAATGAAGTTTTACATAGTGG + Intronic
1043017926 8:74964015-74964037 TGAAATGTATTATAGCACAATGG - Intergenic
1043074527 8:75681011-75681033 TGAACTCTATTATTACAAAATGG + Intergenic
1043361977 8:79483642-79483664 TGAAATCTATTTTTAAAACATGG + Intergenic
1043625164 8:82247877-82247899 TGGAATATATTTTGACATTAAGG + Intergenic
1043926065 8:86038520-86038542 TGAAGTGTATGTTCATATAATGG - Intronic
1044350368 8:91157862-91157884 TCAAATGCATTTTTAGATAAGGG + Intronic
1046350779 8:113007941-113007963 TTATATATAATTTTACATAAGGG - Intronic
1046375055 8:113367568-113367590 TGAAATGTCTTTTTAGATCATGG - Intronic
1046428302 8:114085524-114085546 TAAAATGTATTTTTATATTCAGG + Intergenic
1046763996 8:118050048-118050070 TGAAATGTCATTTTACCTTAAGG - Intronic
1046860157 8:119082313-119082335 TGAAATGTCTTTCTCAATAATGG - Intronic
1046967849 8:120187142-120187164 TACAATGCATTTTTAGATAAAGG - Intronic
1046995955 8:120523034-120523056 TGAAACATATTTTCATATAAAGG + Intronic
1047736385 8:127768852-127768874 TTAAATGTTTTATTACTTAAAGG + Intergenic
1050155326 9:2661236-2661258 AGAAATGTATTTTTAATTAGTGG + Intergenic
1050731810 9:8717427-8717449 TGAACTGTATTTTTGAATATGGG - Intronic
1050965685 9:11798475-11798497 ATAAATGTATTTTTAGAAAAGGG + Intergenic
1051028324 9:12641748-12641770 TTAAATGTATATATATATAAAGG - Intergenic
1051032107 9:12693799-12693821 TGAAATGTCATTTTACATATGGG + Intronic
1051036436 9:12752056-12752078 TGTACTGCCTTTTTACATAAAGG + Intergenic
1051164076 9:14242869-14242891 TGAAATGTACTTTCACACACAGG + Intronic
1051703304 9:19848683-19848705 TTAAATGTAATTTCACATAAAGG + Intergenic
1051804970 9:20982077-20982099 TGAATTGTAATTTTACAAAGAGG + Intronic
1052116493 9:24654112-24654134 TGAAATGTGTTTTTATATCCTGG + Intergenic
1052175245 9:25453825-25453847 TGAAATGAATTTGAACATACAGG - Intergenic
1052292414 9:26858447-26858469 TAAAATGTTTTATTGCATAATGG - Intronic
1052372755 9:27684279-27684301 TCACATGTCTTCTTACATAATGG - Intergenic
1052424597 9:28288276-28288298 TAACGTTTATTTTTACATAATGG + Intronic
1052431336 9:28370680-28370702 TGAAATGTGTTGTTACAGAAAGG + Intronic
1053658561 9:40246286-40246308 ACAAATGAATTTTTATATAATGG + Intronic
1053908934 9:42875554-42875576 ACAAATGAATTTTTATATAATGG + Intergenic
1054370680 9:64392560-64392582 ACAAATGAATTTTTATATAATGG + Intronic
1054526037 9:66129936-66129958 ACAAATGAATTTTTATATAATGG - Intronic
1054678311 9:67882308-67882330 ACAAATGAATTTTTATATAATGG + Intronic
1054920346 9:70536997-70537019 TGGAAAGTATTTTTAAAGAAAGG - Exonic
1055433679 9:76270807-76270829 GGATATGTAATTTTAAATAAAGG + Intronic
1056076068 9:83041758-83041780 TGAAGTGTGTTTTTAAAAAAAGG + Intronic
1057103044 9:92381991-92382013 TTAAATGTATTTTTATATGCTGG + Intronic
1057795248 9:98151480-98151502 TGAATTGCATTTGTACATACTGG - Intronic
1057890595 9:98867115-98867137 TGAAATGGATTTTAAAATATGGG + Intergenic
1058813960 9:108666944-108666966 TGAAAAGTATCTTTATAAAAAGG + Intergenic
1059737076 9:117111973-117111995 TTAATTGTATTTCTACATACTGG + Intronic
1059916162 9:119104269-119104291 TCAACTGTATATTTATATAAAGG - Intergenic
1060034833 9:120245999-120246021 TTAAATGTATTTTTTAAAAAAGG + Intergenic
1060475227 9:123981862-123981884 TGAAATGTACATTTAAAAAATGG + Intergenic
1203695018 Un_GL000214v1:90374-90396 ACAAATGAATTTTTATATAATGG - Intergenic
1203725722 Un_GL000216v2:47924-47946 CGGAATGGAATTTTACATAATGG - Intergenic
1203350002 Un_KI270442v1:71792-71814 TGAAATGGAATCTTACAGAATGG + Intergenic
1203704529 Un_KI270742v1:27059-27081 ACAAATGAATTTTTATATAATGG + Intergenic
1203559473 Un_KI270744v1:38753-38775 ACAAATGAATTTTTATATAATGG - Intergenic
1203641255 Un_KI270751v1:13689-13711 ACAAATGAATTTTTATATAATGG + Intergenic
1186050455 X:5587857-5587879 AAAAAAGTATTTTTAAATAATGG + Intergenic
1186249870 X:7654332-7654354 TAAAATGTATTCTTACATGATGG - Intergenic
1186303216 X:8224061-8224083 TGAAATGGATATTTACATGGTGG + Intergenic
1186943236 X:14535980-14536002 TGAAATGTATTTATTCACATTGG - Intronic
1187451765 X:19403250-19403272 TAAAATGTATTTTTAAAAAAAGG + Intronic
1187621259 X:21058444-21058466 TGAAATGTACTTTGACCAAATGG - Intergenic
1187759221 X:22561584-22561606 TGAAATGTAATTTAAAATATTGG + Intergenic
1188282909 X:28292318-28292340 GGAAATGTGTTTTAACAAAAGGG + Intergenic
1188383014 X:29520781-29520803 TGAAAAGTATATTTAAAGAAAGG - Intronic
1189426263 X:40904043-40904065 TCAATTGTATTTTTATATACTGG + Intergenic
1189489698 X:41460502-41460524 TAAAATTTATTTTTAAAAAATGG - Intronic
1189932630 X:46030980-46031002 TGAAATGGTTTGTTACATAAAGG - Intergenic
1190041514 X:47076302-47076324 TGAAATTTTTTTCTAAATAAAGG + Intergenic
1191060474 X:56290530-56290552 TGAAATGTATTAGGACCTAAAGG + Intergenic
1192382194 X:70628763-70628785 TGGAATGTATTTGTGCAGAATGG + Intronic
1192952393 X:76030689-76030711 TGATTTGTATTTTGACTTAATGG - Intergenic
1193254361 X:79329285-79329307 TGAAATATATTTTTATGTTATGG - Intergenic
1193532106 X:82668398-82668420 TGAAATTTATTTTTTTTTAAAGG - Intergenic
1193890561 X:87040522-87040544 TAAATTATATTCTTACATAAAGG - Intergenic
1193944334 X:87714023-87714045 TGAAATTTATTATTACAGAAAGG + Intergenic
1194035749 X:88869254-88869276 TGAAATGTACCTATACATAATGG - Intergenic
1194069401 X:89301889-89301911 TTGAATGGATTTTTACATGAGGG + Intergenic
1195424446 X:104712569-104712591 TCAAATGTATATTTATTTAAGGG - Intronic
1195450588 X:105007738-105007760 TGAAATGTACTTTTTAATAAGGG + Intronic
1195790420 X:108578621-108578643 TGAAATGTGGTTATATATAAGGG + Intronic
1196246129 X:113402487-113402509 TGTAATGTAGTTTAACATGATGG + Intergenic
1196271680 X:113719614-113719636 TGGAATGTATCTTTTGATAATGG + Intergenic
1197010986 X:121563117-121563139 TGAAATGAATATTTTCTTAAGGG - Intergenic
1197516498 X:127437603-127437625 TGAAATTAACTTTTAAATAATGG - Intergenic
1197593770 X:128441826-128441848 TGAAATGTATTATATGATAAAGG + Intergenic
1197857633 X:130933773-130933795 TTAAATGTATATTTATATGACGG - Intergenic
1199040465 X:143109770-143109792 TTAAATTTATTTTTACCAAATGG + Intergenic
1199103607 X:143836970-143836992 TGTAATATATTTTTAAATCAAGG + Intergenic
1199218857 X:145293776-145293798 TGTAAAGTATGTTTACATTATGG - Intergenic
1199287872 X:146074006-146074028 TGAACTGTACTCTTACAAAATGG - Intergenic
1199510632 X:148617896-148617918 TGAAAGGTATCTTTCCACAAGGG + Intronic
1199614339 X:149644819-149644841 TGAAATGTAAAGTTAGATAAAGG - Intergenic
1200723550 Y:6636031-6636053 TTGAATGGATTTTTACATGAGGG + Intergenic
1201196323 Y:11498043-11498065 TGGAATGCATTTTAACAAAATGG + Intergenic
1201475791 Y:14379468-14379490 TGAAAAGTATATGTAGATAAGGG + Intergenic
1202077110 Y:21047659-21047681 TTAAAAATATTTTTACCTAAGGG - Intergenic