ID: 1016400400

View in Genome Browser
Species Human (GRCh38)
Location 6:143673809-143673831
Sequence CCCTGCGTGAGTCTCTGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 165}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016400400_1016400404 -7 Left 1016400400 6:143673809-143673831 CCTCTGCAGAGACTCACGCAGGG 0: 1
1: 0
2: 1
3: 15
4: 165
Right 1016400404 6:143673825-143673847 CGCAGGGTGAGGCAGAGGCAAGG 0: 1
1: 0
2: 3
3: 59
4: 859

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016400400 Original CRISPR CCCTGCGTGAGTCTCTGCAG AGG (reversed) Intronic
900102668 1:968596-968618 CCCGTCGTGTGTCTCTGCCGTGG - Intronic
900431391 1:2604698-2604720 CCCGGCCTGAGTGTCTGGAGTGG + Intronic
903364098 1:22795227-22795249 ACCTGCCTGAGTCCCTGGAGAGG + Intronic
904944657 1:34190293-34190315 CCCTGCCTAAATCTCTCCAGTGG + Intronic
905435370 1:37951875-37951897 ACCTGCCTCAGCCTCTGCAGTGG - Intergenic
905527668 1:38651304-38651326 TCCTGCCTTAGCCTCTGCAGTGG - Intergenic
907235864 1:53046971-53046993 CCTTGTGTGACTCTATGCAGAGG - Intronic
907312288 1:53545826-53545848 CCTTGCGTGAGTCGCTGCAGAGG + Intronic
911441719 1:97935063-97935085 TCCTGCCTCAGTCTCTCCAGTGG - Intergenic
914423953 1:147556995-147557017 CCCTGCCTGAGGATGTGCAGTGG - Intronic
918615191 1:186536392-186536414 CCCTGTTTTAGTCTCTTCAGTGG + Intergenic
921257949 1:213359438-213359460 GCCTATGTGTGTCTCTGCAGGGG + Intergenic
924854832 1:247865807-247865829 CCCTGCGTGAGTCACTGGGGAGG - Intronic
1063030436 10:2229171-2229193 CTCTGCGGGAATCTCTGCCGGGG - Intergenic
1063878993 10:10511298-10511320 CCCTGCCTCAGTCTCTCCAGTGG - Intergenic
1066694924 10:38069031-38069053 CCTGGCTTGAGGCTCTGCAGGGG + Intergenic
1067576361 10:47411119-47411141 CCCTGCCTCAGCCTCTGCACGGG - Intergenic
1068322437 10:55437255-55437277 CCCTGCCTGATTCTCTGCTAAGG - Intronic
1070395874 10:76010843-76010865 CCATGCTTGCATCTCTGCAGAGG - Intronic
1072502506 10:96032169-96032191 CCCTGAGTGAGTCTTTGAGGAGG + Exonic
1072757440 10:98030432-98030454 CCCGGCGTGAGTATCTGCACCGG - Exonic
1072996238 10:100247114-100247136 CCCTTGGTGAGCCCCTGCAGAGG - Intronic
1073043473 10:100622606-100622628 CCCTCCTTGAGTCTTTCCAGAGG + Intergenic
1074180735 10:111060343-111060365 CCCTGGGGGTGTTTCTGCAGGGG - Intergenic
1076202075 10:128566797-128566819 CCCTGGGTGAGTCTCGCCTGCGG - Intergenic
1078634598 11:13037513-13037535 TCCTGCCTCAGTCTCTGGAGTGG + Intergenic
1079450529 11:20597146-20597168 CCGCGCGTCAGGCTCTGCAGAGG - Intergenic
1080510970 11:32971044-32971066 TCCTGCCTCAGTCTCTGGAGTGG + Intronic
1081853334 11:46289056-46289078 CCCTGTTTGAGGCTCTGCAGAGG + Intronic
1083267686 11:61554362-61554384 CCCTGTGTGAGTCAATGCTGGGG - Intronic
1084370266 11:68737337-68737359 CGCTGCTTCAGTTTCTGCAGTGG - Intronic
1085698420 11:78725441-78725463 GCATGCGTTAGTCCCTGCAGAGG + Intronic
1092357580 12:7809493-7809515 CCCTGCCTCAGCCTCTCCAGTGG + Intergenic
1099171945 12:79375469-79375491 CCCTGCTTAAATCCCTGCAGTGG - Intronic
1104765938 12:131330298-131330320 CCTTCCATGAGTCTGTGCAGTGG + Intergenic
1105418100 13:20230924-20230946 CCCAGCTTTAGTCACTGCAGTGG + Intronic
1108021354 13:46130938-46130960 CCCTCCCTGTGTCTCTGCATAGG - Exonic
1112330280 13:98472066-98472088 CCCTGTGTGTGTCCCTCCAGTGG - Intronic
1113058485 13:106295870-106295892 TCCTCCCTGAATCTCTGCAGAGG - Intergenic
1115344729 14:32330164-32330186 CCCTGGGAGAGCCTCTGAAGTGG + Intronic
1116018517 14:39433543-39433565 CCCTCCGTCTGTCTCTGTAGTGG - Intergenic
1119477216 14:74937798-74937820 CCCTGTTTGAAACTCTGCAGTGG + Intergenic
1120711563 14:87798338-87798360 CCATGAGTGATGCTCTGCAGGGG + Intergenic
1121794944 14:96727037-96727059 CCCTGTCTGAGTCTTTTCAGTGG + Intergenic
1122614888 14:103010437-103010459 CCATGAGTGAGTCTCACCAGAGG - Intronic
1122714708 14:103688626-103688648 CCCTGTGGGAGTCTCTGTCGTGG + Intergenic
1123049886 14:105536104-105536126 TCCTGGGTGAGTCTGGGCAGTGG + Intergenic
1126680121 15:51193961-51193983 CCCTGCCTTAGGCTCTGCTGAGG - Intergenic
1128675882 15:69608074-69608096 CCCTTAGAAAGTCTCTGCAGGGG + Intergenic
1129114229 15:73356296-73356318 TCCTGCTTGAGTCTCTGGAGTGG + Intronic
1131298495 15:91173382-91173404 CCCTGCCTAAGCCTCTCCAGTGG - Intronic
1132074612 15:98809755-98809777 CCCTCAGTGAGTGCCTGCAGGGG + Intronic
1132717773 16:1300786-1300808 CCCGGTGTGCGACTCTGCAGAGG + Intergenic
1132731110 16:1362461-1362483 CCCTGCCAGAGGCCCTGCAGCGG + Exonic
1132759443 16:1501692-1501714 CTCTGCGGGGGTCTCTGCAGGGG - Exonic
1133330559 16:4970651-4970673 ACGTGAGTGAGACTCTGCAGTGG + Intronic
1133336458 16:5009720-5009742 CCCTGCTTGAGTTAATGCAGTGG - Intronic
1134481495 16:14623401-14623423 TCCTGCCTGAGCCTCTGGAGTGG - Intronic
1137492541 16:48944958-48944980 CCCTGCATGAGTCTCATCAGTGG - Intergenic
1142197788 16:88746698-88746720 CCCTGCCTGAGCCTCGTCAGAGG - Intronic
1142316996 16:89353881-89353903 CCCTGCATGAGAGGCTGCAGAGG - Intronic
1142984919 17:3689985-3690007 CCCTCCGTGGGTCTCTGCCTGGG - Intronic
1144206030 17:12980129-12980151 CCCTGGTTGAGTCCCTGCACAGG - Exonic
1144556373 17:16286268-16286290 CCCTGCTTGAGTTCCAGCAGCGG + Intronic
1144677777 17:17172886-17172908 CCCTTCCTGTGTCTTTGCAGAGG + Intronic
1151599462 17:75097456-75097478 CCCTGCCTGATTGTCTGCAGAGG + Intronic
1151847780 17:76669724-76669746 TCCTGCTTCAGTCTCTGCAGTGG + Intergenic
1151908157 17:77062981-77063003 TCCTGCCTGAGCCTCTGGAGTGG + Intergenic
1152023506 17:77794418-77794440 CCCAGGGTGGGTCTCTGCATGGG - Intergenic
1152073671 17:78146301-78146323 CCCTGGGTGGGTGCCTGCAGTGG - Intergenic
1152568387 17:81110542-81110564 CCCGGCGTGCGTCTTTGCCGTGG + Intronic
1153314693 18:3710372-3710394 CCCAGCTTCAGGCTCTGCAGAGG + Intronic
1155198406 18:23496511-23496533 CCCTGCCTGTGACTCTGCTGGGG - Intergenic
1156631549 18:38975385-38975407 CCCTAGGTGAGTCACTGTAGTGG - Intergenic
1159644218 18:70898334-70898356 CCCTGCTTGAATCCTTGCAGTGG - Intergenic
1160298483 18:77658310-77658332 GCCTGGGTGAGTACCTGCAGGGG + Intergenic
1162203694 19:9039898-9039920 CCCTGGTTGAGAATCTGCAGGGG - Intergenic
1162342785 19:10102003-10102025 TCCTGCCTCAGTCTCTGGAGTGG - Intronic
1162783081 19:13017248-13017270 CCCGGTGTCATTCTCTGCAGGGG + Intronic
1164418862 19:28069730-28069752 TCCTGCCTCAGTCTCTGGAGTGG - Intergenic
1164814067 19:31180835-31180857 CCCAGCGTGAGCCTCTGCACAGG - Intergenic
1165317824 19:35067257-35067279 GGCTGCATGAGGCTCTGCAGAGG - Intergenic
1165742942 19:38214318-38214340 GGCTGCGGGTGTCTCTGCAGCGG - Intronic
927577073 2:24208823-24208845 CCCTGCTACAGTCCCTGCAGGGG - Intronic
931762451 2:65430662-65430684 CCCCGCGCGCGTCTTTGCAGGGG - Intronic
932721034 2:74139152-74139174 CCCTGCGGGATTCCCTGGAGGGG - Intronic
933791850 2:85889163-85889185 CCCCGGGTGCGTCCCTGCAGGGG - Intergenic
934077283 2:88439071-88439093 CCCTGTCTGAGACTCTGCTGTGG + Intergenic
935487471 2:103675404-103675426 ACAAGCGTGAGTCACTGCAGCGG - Intergenic
935676056 2:105595796-105595818 GCCTGCAGGAGTCTCTGCTGTGG + Intergenic
937002385 2:118479377-118479399 TTCTCAGTGAGTCTCTGCAGAGG + Intergenic
937065777 2:119016087-119016109 CTCTTGGTGAATCTCTGCAGAGG + Intergenic
937316846 2:120937157-120937179 CCCTGGGTGAGTGTCCTCAGAGG - Intronic
938081797 2:128374153-128374175 CCCTGCTGGAGTCTGTGCAGTGG - Intergenic
938370065 2:130763131-130763153 CGCTGCGAGGGTCCCTGCAGGGG - Exonic
938390694 2:130902727-130902749 CCCAGCGTGAGTGCATGCAGAGG + Intronic
939309400 2:140454909-140454931 GCCTGCCTGAGTCACTACAGTGG - Intronic
945314725 2:208359805-208359827 CCCTGCCTGGGTTCCTGCAGGGG + Intronic
946773032 2:223108901-223108923 CACTGCGTGAAGCTCTGTAGGGG + Intronic
947253587 2:228136462-228136484 TACTGCATGAGTCACTGCAGTGG - Intronic
948413397 2:237782470-237782492 GCCTGCCTGAGTATCTGAAGGGG + Intronic
949047909 2:241880596-241880618 CCCTGGGAGAGTCCCTCCAGGGG + Intergenic
1170569832 20:17626488-17626510 CCCTGTGTGCCTCTCAGCAGAGG - Intronic
1171221761 20:23404641-23404663 CTCTGGGTGAAGCTCTGCAGTGG - Intronic
1172975157 20:38900561-38900583 CCCTGCCTCTTTCTCTGCAGTGG + Exonic
1173086420 20:39923362-39923384 CCCTCCATGTGTCCCTGCAGAGG + Intergenic
1179539363 21:42074167-42074189 CCCTGCAGGAGTCTCTGCTCCGG + Intronic
1180032247 21:45220438-45220460 CCCTGCATTAGTCTCAGAAGTGG + Intronic
1180783742 22:18535645-18535667 CCCTGGGTGGGTCTCTGGTGTGG + Intergenic
1181127311 22:20709694-20709716 CCCTGGGTGGGTCTCTGGTGTGG + Intronic
1181240643 22:21474997-21475019 CCCTGGGTGGGTCTCTGGTGTGG + Intergenic
1184408977 22:44315814-44315836 CCCTGCCTGAGCCACTGCTGGGG + Intergenic
1184473294 22:44707716-44707738 CCCAGCTGGGGTCTCTGCAGTGG - Intronic
950007935 3:9703669-9703691 CCCTGCGCAAGTCTCTGGGGTGG - Intergenic
952998066 3:38904591-38904613 CCCTGCATGTGTCCCTGCAGCGG - Intronic
953236195 3:41109795-41109817 CACAGGGTGAGCCTCTGCAGTGG + Intergenic
954291479 3:49652283-49652305 CCCTGAGGGAGGCTCAGCAGAGG + Exonic
954698345 3:52439295-52439317 CCCTTCCTGAGTCTCTAGAGGGG + Intronic
954982601 3:54760169-54760191 CCCTGCATCAGTCCCTTCAGAGG - Intronic
955778038 3:62454698-62454720 CCCTCTGTGAAGCTCTGCAGTGG - Intronic
961573314 3:127816048-127816070 CACTCTGTCAGTCTCTGCAGGGG - Intronic
967439362 3:189488959-189488981 CACTGCCTGCTTCTCTGCAGGGG + Intergenic
967642588 3:191883696-191883718 CTGTCAGTGAGTCTCTGCAGGGG - Intergenic
967891929 3:194369778-194369800 CCGGGCGTGAGTCACTGCAGAGG + Intergenic
968611178 4:1557804-1557826 CCCTGTGTGTGGCTGTGCAGGGG - Intergenic
982628779 4:157804495-157804517 CCCTGGATGAGTTTCTGCTGTGG - Intergenic
983788078 4:171759458-171759480 CCCTACTTGAGCCTCAGCAGTGG - Intergenic
986030135 5:3885888-3885910 CCCTTCCTCAGTCTCTACAGAGG + Intergenic
990571398 5:57082600-57082622 CCATTCATGAGTCTCTGCTGTGG + Intergenic
996765466 5:127030796-127030818 CGCTGCGGGACTCTCTGCAATGG + Exonic
997577784 5:134996185-134996207 CCCTGCGTGAGCCCCGGAAGGGG - Intronic
999171550 5:149599358-149599380 CCCTGCCTGAGGGCCTGCAGGGG - Intronic
1001078918 5:168652555-168652577 ACCTGTATGAGTCTCTGAAGTGG - Intergenic
1001081261 5:168669331-168669353 CCCTGCATGAGTCACTACACAGG - Intronic
1001712392 5:173789221-173789243 CCCTGCCTGAATCTCTGGAAAGG + Intergenic
1001995480 5:176153994-176154016 CACTGCCTGAGCCTCAGCAGAGG + Intergenic
1005862677 6:29913550-29913572 CTCTGCATGAGACACTGCAGAGG - Intergenic
1006248638 6:32761924-32761946 CCCGCCGTGATTCTCCGCAGAGG - Exonic
1006566069 6:34958603-34958625 CCCCGCTTGAATCTCTTCAGCGG + Intronic
1006649025 6:35535774-35535796 CACTGCATGAGTGACTGCAGAGG - Intergenic
1011554857 6:88563732-88563754 CCCTCCATCAGTCTCTGCTGAGG + Intergenic
1011988116 6:93475717-93475739 CCTTGCTTGAATCTTTGCAGGGG + Intergenic
1016354990 6:143209050-143209072 CCCTGAGTGTCTCTCTGCACTGG + Intronic
1016400400 6:143673809-143673831 CCCTGCGTGAGTCTCTGCAGAGG - Intronic
1016749779 6:147619886-147619908 CCCTGATGGAGTCACTGCAGAGG + Intronic
1017777880 6:157693742-157693764 CCGTGTGTGAGTCCCAGCAGGGG + Intergenic
1017920713 6:158869809-158869831 CCCAGCGCGAGGCTCTGCACCGG - Intergenic
1019116631 6:169769410-169769432 CCCTGGGTGGGACTCTGCTGGGG - Intronic
1019503244 7:1376122-1376144 CCCTGATGGAGTCTCTCCAGAGG + Intergenic
1019519617 7:1454780-1454802 CTCTGCGTGAGTCTCTCCCCTGG + Intronic
1019701692 7:2477419-2477441 CCCTGCCTGTGTGTCTGAAGAGG + Intergenic
1021276616 7:18659780-18659802 GCCTGTGTGAATCTCTGCTGAGG - Intronic
1022207521 7:28179559-28179581 CCCTGGGGGTGTCTCTCCAGCGG + Intronic
1023927984 7:44684241-44684263 CCTTGCGTCAGTCTCTCCAATGG - Intronic
1024202410 7:47120589-47120611 CCCTGCCTGAGTCCCAGCAGAGG - Intergenic
1029349112 7:100000505-100000527 CCCTGGGTCAGTTTCTCCAGAGG + Intergenic
1030871276 7:114759261-114759283 CCTTGCCTGAGTCGTTGCAGGGG - Intergenic
1033157866 7:138971913-138971935 CCTTGCTTGACTGTCTGCAGTGG - Intronic
1033210055 7:139453814-139453836 CACTGAGTGAGTCACTGCACTGG + Intronic
1035464324 7:159064812-159064834 CCCTCCTTCAGTCCCTGCAGAGG + Intronic
1036701875 8:11018394-11018416 CCCTTCCTGAGTTTGTGCAGGGG - Intronic
1041522413 8:58770977-58770999 CTCTGGGTGAGGATCTGCAGAGG + Intergenic
1043383222 8:79724618-79724640 CACTGCTTGAGTTTCTTCAGTGG + Intergenic
1048995475 8:139791363-139791385 ACCTGTGTGAGTGTGTGCAGGGG - Intronic
1048995488 8:139791464-139791486 GCCTGTGTGAGTCTGTGCACGGG - Intronic
1049139545 8:140940343-140940365 GCCTGCCTGAGTCTCTCAAGTGG - Intronic
1055393175 9:75845397-75845419 ACCAGCGTGAGGCTTTGCAGTGG - Intergenic
1056072380 9:83001064-83001086 CCCTCTGTGATCCTCTGCAGAGG - Exonic
1057267811 9:93630535-93630557 CCCTCCAAGATTCTCTGCAGAGG - Intronic
1057571392 9:96206896-96206918 CCCTGCTGCAGTGTCTGCAGAGG - Intergenic
1058887777 9:109335299-109335321 CCGCGTGTGAGTTTCTGCAGTGG + Intergenic
1059598995 9:115755607-115755629 TCCTGCCTCAGTCTCTGGAGTGG - Intergenic
1060736579 9:126070132-126070154 CCCTGCCTGAGCCTCATCAGTGG - Intergenic
1061377688 9:130235872-130235894 CCCAGTGCGAGGCTCTGCAGAGG - Exonic
1061836575 9:133333602-133333624 CCCTGCCAGACTCGCTGCAGAGG + Intronic
1062357371 9:136171191-136171213 CCCTGTGTGGGTCACTGAAGAGG - Intergenic
1062524478 9:136972707-136972729 CCCTCCGTGATTCTCTGCCTGGG + Intergenic
1186383168 X:9082552-9082574 CCCTGCGTTTGTTTCTGCATTGG - Intronic
1187255310 X:17636588-17636610 CCCTGTGTCAGCCTCCGCAGAGG - Intronic
1187487666 X:19719960-19719982 CCCTGCGTGGCTCTCTGCCTCGG + Intronic
1195759773 X:108233873-108233895 GCCTGCGTGTGTCTGTGCAGAGG - Intronic
1202044704 Y:20726742-20726764 GGCTGCGTGATTCTCTGTAGTGG + Intergenic