ID: 1016401340

View in Genome Browser
Species Human (GRCh38)
Location 6:143684211-143684233
Sequence TGGGCATCCCAGAGGTAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 163}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016401333_1016401340 28 Left 1016401333 6:143684160-143684182 CCAGGCTCAAATATGCAACTCCC 0: 1
1: 0
2: 2
3: 15
4: 156
Right 1016401340 6:143684211-143684233 TGGGCATCCCAGAGGTAACATGG 0: 1
1: 0
2: 0
3: 11
4: 163
1016401336_1016401340 7 Left 1016401336 6:143684181-143684203 CCTATTTGACAGGTCTGCTTGAA 0: 2
1: 0
2: 1
3: 15
4: 203
Right 1016401340 6:143684211-143684233 TGGGCATCCCAGAGGTAACATGG 0: 1
1: 0
2: 0
3: 11
4: 163
1016401335_1016401340 8 Left 1016401335 6:143684180-143684202 CCCTATTTGACAGGTCTGCTTGA 0: 2
1: 0
2: 2
3: 11
4: 122
Right 1016401340 6:143684211-143684233 TGGGCATCCCAGAGGTAACATGG 0: 1
1: 0
2: 0
3: 11
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016401340 Original CRISPR TGGGCATCCCAGAGGTAACA TGG Intronic
901611224 1:10499997-10500019 TGGGTGTCCCAGGGGTAAGATGG - Intronic
902834318 1:19036823-19036845 CGGGCATCCCAGAGGAGGCAAGG - Intergenic
905107277 1:35571769-35571791 TGGGTATCCCAGAAGGCACATGG - Intergenic
910937603 1:92497892-92497914 TTGGCATCCCAGATGTAACTTGG - Intergenic
911555207 1:99335938-99335960 TGGGCATCCCAAAATGAACAAGG - Intergenic
914423454 1:147551683-147551705 TGGGCATGGCAGAGGGAAAATGG - Intronic
915057327 1:153145826-153145848 TGGGCATGTCAGAGGGAAGAAGG + Intergenic
915116875 1:153606911-153606933 TGAGCATCCCAGAGGGACCAGGG + Exonic
915455168 1:156035732-156035754 TGGGTAACCCAGAGGTAATGTGG - Exonic
918138496 1:181699899-181699921 TAGGCATCTCGGATGTAACATGG - Intronic
920117316 1:203629825-203629847 TGGGAGTCCCAGGGGTAAGACGG - Intronic
920117638 1:203631630-203631652 TGGGAGTCCCAGGGGTAAGACGG + Intronic
921623495 1:217352570-217352592 TGTGAATCCCAGAGGTGAGAAGG + Intergenic
922466328 1:225847560-225847582 TGAGCATCCCAGGGGTCCCAGGG - Intronic
924591016 1:245404415-245404437 TGGGGATCCCTGAGGTGTCAGGG + Intronic
1063129293 10:3163775-3163797 TGTGCATCCCGGAGCTTACATGG - Exonic
1065195259 10:23258113-23258135 TGGGGATGCCAGAGGCCACATGG - Intergenic
1067168696 10:43886063-43886085 TGGTGATCCCACAGGTAGCAAGG - Intergenic
1069641255 10:69956927-69956949 TGGGCAGGACAGGGGTAACAAGG - Intronic
1072366033 10:94710820-94710842 TAGGCATGCCACAGGTCACATGG + Intronic
1072790781 10:98316166-98316188 TGGCCATCACAGGGGTAAGATGG - Intergenic
1074432576 10:113406494-113406516 CGGGAATCCCAGAAGTAGCAAGG + Intergenic
1075549419 10:123381251-123381273 TGGGCAGCTCAGAGGTGACAGGG - Intergenic
1075893765 10:125977536-125977558 TGGGCATCCCAGGAGTGCCAAGG - Intronic
1076294568 10:129374556-129374578 AGGGCATCCCAGAGGTGGCTTGG + Intergenic
1076789630 10:132769865-132769887 TGGACACCCCAGTGGTAGCATGG + Intronic
1079438687 11:20485728-20485750 TGGGCATCCCAGAGAAAAGGAGG + Intronic
1079483995 11:20914634-20914656 AGGGCATTCCAGAGTTAACCCGG - Intronic
1080514424 11:33006866-33006888 TAGGCATCCCAAACTTAACATGG - Intergenic
1080847168 11:36036552-36036574 TGAGCATCCCAGAGGTTATGTGG + Intronic
1081748217 11:45487952-45487974 TGGGGATCCCAGAGGCTAAAGGG - Intergenic
1082282524 11:50285576-50285598 TGGGCATGGCAGAGGGAACTGGG + Intergenic
1083200761 11:61119710-61119732 TTGGCCTCTAAGAGGTAACAAGG + Intronic
1083275811 11:61596372-61596394 TGGGCATCCCAGATGAGAAAAGG - Intergenic
1083451547 11:62749378-62749400 TGGGGAAAGCAGAGGTAACAAGG + Intronic
1083754843 11:64786450-64786472 TGGACATGCCACAGGGAACACGG + Intergenic
1086554112 11:88089230-88089252 TGGGCAACCCTGAGGTGGCAGGG + Intergenic
1089283015 11:117387485-117387507 TGGGCATCCCAGTGGTCCCCAGG - Intronic
1096215193 12:49794639-49794661 GGGGCTTCCCAGAGGTCAAAAGG - Intronic
1096573094 12:52535130-52535152 TGTGGATCCCAGAGGTGGCAAGG - Intergenic
1099153950 12:79151174-79151196 TGGGCATGTCAGAGGTGTCAAGG + Intronic
1099948816 12:89276997-89277019 TGGTCACTCCAGAGGTAAAAAGG - Intergenic
1105600998 13:21886675-21886697 TGGGCCACTCAGAGGTAACCTGG + Intergenic
1105601509 13:21892367-21892389 TGGGCAAAGCAAAGGTAACATGG + Intergenic
1108356155 13:49630456-49630478 TGTGAATTCCAGAGGTCACAAGG + Exonic
1108356878 13:49636240-49636262 TGGGAATCCCACAGGGTACAAGG + Intergenic
1109122481 13:58475382-58475404 TGGATATCCCAGATGTCACAAGG + Intergenic
1111480926 13:88825335-88825357 TAGGCATCCCAAATATAACATGG + Intergenic
1112397177 13:99043684-99043706 AGGACATCCCAGAAGGAACATGG + Intronic
1112662096 13:101521681-101521703 TGGGAATCACACAGGGAACAAGG - Intronic
1114539496 14:23444092-23444114 TGGGCATTCCGGAGGAAAGAAGG + Intergenic
1115798340 14:36963774-36963796 TGCGCAACCCAGAGGGATCATGG + Intronic
1119041890 14:71281994-71282016 TGGGTATCACAGAGGTGGCAAGG + Intergenic
1119614466 14:76089745-76089767 TGGTCAGCCCAGAGGAAGCAAGG + Intergenic
1119768779 14:77207205-77207227 TGGGGGTCCCAGAGGTGAGATGG + Intronic
1121529953 14:94645249-94645271 TGGGGATCCCAAAGGAAATAAGG + Intergenic
1122357376 14:101131833-101131855 TGGGCATAGCAGAGATAAGAGGG + Intergenic
1125969785 15:43902526-43902548 TGGGAATCTCAGAGTTAAGATGG - Intronic
1127520596 15:59739763-59739785 TGGGGATCCCACAGGAAATAAGG - Intergenic
1127617338 15:60700262-60700284 TTGCCATCCCAGAGGTACTAAGG + Intronic
1129335296 15:74848569-74848591 TGGGCATCACAGAGGGAATTAGG - Intronic
1131134149 15:89920537-89920559 CAGGCAGCCCAGAGGCAACAAGG + Intergenic
1131394800 15:92077717-92077739 TGGGCTTCCCAGAGCCAGCAGGG + Intronic
1132422167 15:101679871-101679893 TGTGCAACCCAGAAGTAACGAGG - Intronic
1133244833 16:4441330-4441352 TGGGCATCCCAGGTCTACCAAGG - Intronic
1134252590 16:12584927-12584949 TAGGCATCTCAGATGTAACATGG + Intergenic
1135762607 16:25149100-25149122 TGGGCTGGCCAGAGGCAACAAGG + Intronic
1144891724 17:18498098-18498120 TTGGCATCCAAAAGGTTACAAGG - Intergenic
1145140498 17:20446219-20446241 TTGGCATCCAAAAGGTTACAAGG + Intergenic
1151473072 17:74329978-74330000 TGGGGAGCCCAGAGGTAAACAGG - Intronic
1152282936 17:79396082-79396104 TGAGCATCTCAAAAGTAACAGGG + Intronic
1154959394 18:21292916-21292938 TGGGCATCTCAGAGGCATAAAGG + Intronic
1155266588 18:24100438-24100460 TGGGGATCCCAGTGGTATCTTGG + Intronic
1157406169 18:47424266-47424288 TGAGCATACCAGAGGCACCAAGG - Intergenic
1157710936 18:49849286-49849308 TGGGGAACCCAGAGGTGACCTGG - Intronic
1157815011 18:50723904-50723926 TGGGCTTCCCAGAAGTATCTGGG + Intronic
1159881678 18:73864313-73864335 TGGGCATCCCAGAGGGTGTATGG + Intergenic
1161279551 19:3438325-3438347 TGGGAATCGCAGAGCTAGCAGGG + Intronic
1163265290 19:16217199-16217221 TGGGCCTCCCACAGGAAACTAGG - Intronic
1163797891 19:19347859-19347881 TGGGGATCCCAGGGCTAAAAGGG - Intronic
1166233998 19:41442779-41442801 TGGGCAAGCCAGAGGTCAAATGG + Intergenic
1168677335 19:58288321-58288343 TTGGCATCTCAGAGGTGCCAGGG + Intronic
926737132 2:16082186-16082208 TGGGGACCCCAGAGGCAGCAAGG + Intergenic
926750736 2:16196815-16196837 GGGGCAGCCCATAGGTGACAAGG - Intergenic
930090868 2:47530369-47530391 TGTGCAGCCCTGAGGTACCAGGG - Intronic
931831303 2:66054284-66054306 TGGGCATCTCAGAATTAATATGG + Intergenic
933535037 2:83561455-83561477 TGGACATTCCAGAGATAAAAGGG + Intergenic
933808465 2:86017209-86017231 AGGGCAGACCAGAGGTAAGATGG + Intergenic
935340190 2:102052915-102052937 TGGGCAGCCCAGTAGTCACATGG + Intergenic
936432074 2:112473450-112473472 TGGACATCCCAGAGGGAGAATGG - Intergenic
938841419 2:135168585-135168607 TGGGCTCCCCAGAGGAAAGAAGG + Exonic
939518757 2:143203143-143203165 GGGACATCCCAAAGATAACAGGG - Intronic
942436000 2:175977068-175977090 TAGGCATCTCATAAGTAACATGG - Intronic
944081820 2:195796596-195796618 TTGGCATCCAAGAGGTGGCAAGG + Exonic
945754432 2:213829403-213829425 TGGGCCTACCAGGGGCAACAGGG - Intronic
945923838 2:215783288-215783310 AGGGTCTCCCAGAGGTAGCATGG - Intergenic
945966925 2:216198077-216198099 TTGGCTTCCCAGTGGTAACAGGG - Intronic
947319339 2:228898644-228898666 TGGACCACCAAGAGGTAACATGG - Intronic
948528301 2:238587088-238587110 AGGGCAGCCCAGAAGTACCAGGG - Intergenic
1172099466 20:32476459-32476481 TGGGCATCCAGGAAGTAGCAAGG - Intronic
1172519495 20:35557744-35557766 TGGGCATCCCCTAGTTAACCGGG + Intergenic
1176128219 20:63485371-63485393 TGGGGACCCCAGTGGGAACAGGG + Intergenic
1178810730 21:35878855-35878877 TGGGCATCCTATTGGTAACATGG - Intronic
1179385196 21:40934692-40934714 TGTGCATCCCAGAGGTAGAAAGG + Intergenic
1180103195 21:45599508-45599530 ATGGCAGCCCAGAGGGAACAAGG - Intergenic
1181758905 22:25044212-25044234 TTGCCATGCCAGAGTTAACAGGG + Intronic
1182667503 22:31970542-31970564 TGGGCATCCCGGCGGTTCCAGGG - Intergenic
1182693677 22:32181425-32181447 TTTGTACCCCAGAGGTAACAGGG - Intergenic
1182964080 22:34505170-34505192 TGGGTAACCCTGAGGTAGCAGGG - Intergenic
1183058338 22:35320384-35320406 TGGGAATCACAGAGGGGACAGGG + Intronic
1184065226 22:42114971-42114993 TGGGCGTGCCAAAGGTAAGAGGG - Intergenic
951620396 3:24595198-24595220 TGAGCAGCCCAGAGTTCACAGGG + Intergenic
953043272 3:39273594-39273616 TGAGCATGCCAGAGCTAGCAAGG - Intronic
953469424 3:43154469-43154491 GGGTCAACCCAGAGGTAAAAAGG + Intergenic
954798224 3:53172276-53172298 TGGCCTTCCCAGCGGAAACAAGG - Intronic
957440436 3:80239626-80239648 AGGGCATCACAGAGGTCAAATGG + Intergenic
957646574 3:82938970-82938992 TGGGCATCCCAGCGCTCTCAGGG + Intergenic
959874543 3:111366838-111366860 TGAGCATCTGAGAGGTAACAAGG - Intronic
961363022 3:126380061-126380083 TGGGCAGCCCAGAGCCCACAGGG - Intergenic
963732079 3:148984615-148984637 TGGGTAACCCAGAGGTAATGTGG - Intergenic
964525519 3:157612357-157612379 ATGGCATCCCAGAGGGAAAAAGG + Intronic
964803873 3:160585384-160585406 TGGGCACCACAGAGGCAAGAGGG + Intergenic
965550707 3:169962192-169962214 TGGACATCCAAGAGGAAATATGG - Intergenic
969230410 4:5826613-5826635 TGGCCATCCCTGAGGTCACCTGG - Intronic
972693056 4:41418599-41418621 TTGGAATCCCACAGGCAACAAGG - Intronic
973866388 4:55118396-55118418 TGGGCAAAAAAGAGGTAACACGG + Intronic
974522741 4:63006108-63006130 TGAGGATCACAGAGGTTACAGGG + Intergenic
980539725 4:134177738-134177760 TGGCCCTACCAGAGGTAACCAGG + Intergenic
982026931 4:151260324-151260346 TTGGCATCTCAAGGGTAACATGG + Intronic
991350575 5:65716707-65716729 TAGGCATCCCAAATTTAACATGG - Intronic
991695101 5:69263630-69263652 TGGGAATCACAGTGCTAACAGGG + Intronic
991974981 5:72176799-72176821 TGGGTGTCTCAGAGGCAACAGGG - Intronic
995595849 5:113746819-113746841 TGGGCATTTAAGAGGTGACATGG + Intergenic
996785625 5:127233770-127233792 TGGGCAGCCCAGAGTTAAGCTGG - Intergenic
997214969 5:132102837-132102859 TGGGCATCCCATCGGTAGTATGG + Intergenic
997565981 5:134886750-134886772 TCAGCATCCCCGAGGTATCATGG + Intronic
999331293 5:150675132-150675154 TTGCCTTCCCAAAGGTAACATGG + Intronic
1000848226 5:166307698-166307720 TAGTCATCCCAGAGGTCACAAGG + Intergenic
1001101197 5:168815919-168815941 TTGGCATGCAAGAGGAAACAAGG - Intronic
1001407831 5:171488437-171488459 TGAGTATCCCGGATGTAACATGG + Intergenic
1001837283 5:174843085-174843107 TGGGAAGCCCAGAGGCCACAAGG + Intergenic
1003631974 6:7795443-7795465 TGGGGATCCCTGAACTAACAGGG - Intronic
1007826940 6:44607669-44607691 TGGGCTTACCAGGGGCAACATGG + Intergenic
1008144774 6:47878199-47878221 TGGGCTGGCCAGGGGTAACAAGG - Exonic
1010780655 6:79942902-79942924 TGGACATCCCAGAGGCTTCAAGG + Intronic
1016401340 6:143684211-143684233 TGGGCATCCCAGAGGTAACATGG + Intronic
1016902472 6:149116009-149116031 TGAGCATCGCATAGGTAGCACGG - Intergenic
1017943349 6:159073149-159073171 TGGGAATGCCAGAGGGAGCAAGG - Intergenic
1018908381 6:168088179-168088201 GGAGCATCCCAGAGGCAGCATGG - Intergenic
1020839039 7:13192166-13192188 GGGGTATCCCTGAGGTAATATGG - Intergenic
1021550896 7:21869847-21869869 GGGGCATCCCAGAGGACACTGGG - Intronic
1025606603 7:63044212-63044234 TAGGCCTCCCAGAGGTCCCAGGG - Intergenic
1031081193 7:117258526-117258548 AGGGCATTCCAGAGTTAACCTGG - Intergenic
1033245719 7:139714902-139714924 TGGGCAGCTGGGAGGTAACATGG - Intronic
1034274229 7:149817033-149817055 TGGGCATCCCAGCGGCAGCCGGG + Intergenic
1035382230 7:158447483-158447505 TGGGCAGCCCAGAAGCAGCAGGG + Intronic
1039449579 8:37661253-37661275 TGGCCATCTCAGATTTAACACGG - Intergenic
1042705566 8:71662931-71662953 TGGGTATCTCAGAGTTAAAAGGG - Intergenic
1047711424 8:127556341-127556363 TGGTCTTCCCAGAGGTTAAATGG - Intergenic
1049021879 8:139962744-139962766 TGGGCCTCCCTGAGCTGACAGGG - Intronic
1049229353 8:141474042-141474064 AGGGCATCTCAGAGGAGACAAGG - Intergenic
1049377115 8:142294548-142294570 TGGGAATCCCAGAGGAGGCAGGG - Intronic
1049392342 8:142378700-142378722 GGGGTTGCCCAGAGGTAACAAGG + Intronic
1050206206 9:3199066-3199088 TGGGCATCTTAAAGGTCACATGG + Intergenic
1051069651 9:13149627-13149649 TGGGCATCCCACAGTAAACAAGG - Intronic
1052721367 9:32174957-32174979 AGGGCTTCCCAGAGGAAATAAGG - Intergenic
1061461962 9:130747085-130747107 TGGGCACCCCTGAGGGAGCATGG + Intronic
1061779463 9:132987217-132987239 TGGGAAGCCCAGAGGGAGCAAGG - Intronic
1061855507 9:133439966-133439988 TTGGCTTCCAAGAGGAAACACGG - Intronic
1061921355 9:133784212-133784234 AGGGCCTCCCACAGGGAACATGG + Intronic
1187445291 X:19355705-19355727 TGTGCGTCCGAGAGGCAACAAGG + Exonic
1189845123 X:45128859-45128881 TGGGCTTCCAAGAGGCAAAAGGG + Intergenic
1190023792 X:46903779-46903801 TGGGAGTCCCAGCGGTACCAGGG + Intergenic
1190936727 X:55004532-55004554 TCTGCATCACAGAGGTAACAGGG - Intronic
1201076467 Y:10193667-10193689 TGGGCTTCCCAGAGTTGGCAGGG - Intergenic