ID: 1016402365

View in Genome Browser
Species Human (GRCh38)
Location 6:143694206-143694228
Sequence AGGAAGAAGTAGAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4160
Summary {0: 1, 1: 3, 2: 72, 3: 662, 4: 3422}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016402365 Original CRISPR AGGAAGAAGTAGAAGGAGGA AGG Intronic
Too many off-targets to display for this crispr