ID: 1016402609

View in Genome Browser
Species Human (GRCh38)
Location 6:143696811-143696833
Sequence AGCAAACACAAGTGGAGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 408
Summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 373}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016402609_1016402617 2 Left 1016402609 6:143696811-143696833 CCCTCTCTCCACTTGTGTTTGCT 0: 1
1: 0
2: 0
3: 34
4: 373
Right 1016402617 6:143696836-143696858 CCTTAGGGTACTGTTCTAACAGG 0: 1
1: 0
2: 0
3: 2
4: 59
1016402609_1016402619 27 Left 1016402609 6:143696811-143696833 CCCTCTCTCCACTTGTGTTTGCT 0: 1
1: 0
2: 0
3: 34
4: 373
Right 1016402619 6:143696861-143696883 ATATTTGCTTCACAGTGGAAAGG No data
1016402609_1016402618 22 Left 1016402609 6:143696811-143696833 CCCTCTCTCCACTTGTGTTTGCT 0: 1
1: 0
2: 0
3: 34
4: 373
Right 1016402618 6:143696856-143696878 AGGAGATATTTGCTTCACAGTGG 0: 1
1: 0
2: 0
3: 26
4: 343

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016402609 Original CRISPR AGCAAACACAAGTGGAGAGA GGG (reversed) Intronic
900077630 1:830787-830809 ACCAAAGACAGGTGGAGAGCAGG - Intergenic
904603306 1:31685325-31685347 AGGAAACAGAGGTGGAGAGAAGG + Intronic
904922875 1:34022471-34022493 AGCACACACAAGAGTAGAGAAGG + Intronic
905301214 1:36987391-36987413 AGGAAACACTGGTGAAGAGAGGG + Intronic
907338410 1:53715866-53715888 TGCAAACAGAAGTGGAGAATGGG + Intronic
907400641 1:54222939-54222961 AGCAAACACGAGTGGATGGATGG + Intronic
908424192 1:63989790-63989812 AGCCAAAATAAGGGGAGAGATGG - Intronic
908633071 1:66131836-66131858 AGCAAACACATATGGAAACAAGG + Intronic
909582960 1:77258761-77258783 AGCAAAAAGTAGTGGAGAGGTGG + Intergenic
910118080 1:83754784-83754806 AACAATCACAAGAGCAGAGAGGG + Intergenic
910393732 1:86770886-86770908 ACCAAACATGAGTGGAGAGATGG - Intergenic
911220321 1:95238623-95238645 AAAAAACACAAGTGTAGGGAAGG + Intronic
912179456 1:107200928-107200950 AGCAAACACAATTCAAGGGAGGG - Intronic
912577390 1:110685971-110685993 AGCAAGGAGAAATGGAGAGAGGG - Intergenic
912643288 1:111368212-111368234 AGAAAACTAAAGTGCAGAGAGGG - Intergenic
912922157 1:113879604-113879626 AGCAAACACAGCTGTAGATAGGG - Intronic
913594896 1:120365847-120365869 AGCTAACAGAAGTGGGGAGGAGG + Intergenic
914092372 1:144513139-144513161 AGCTAACAGAAGTGGGGAGGAGG - Intergenic
914306160 1:146420732-146420754 AGCTAACAGAAGTGGGGAGGAGG + Intergenic
914595892 1:149152077-149152099 AGCTAACAGAAGTGGGGAGGAGG - Intergenic
914692951 1:150047377-150047399 AGCAAAAACAAGTTTAAAGAAGG - Intergenic
916441734 1:164833136-164833158 AGCAAAAAAAAGTTCAGAGAAGG + Intronic
916547645 1:165821535-165821557 AGCAAACGCAAGTGCAGGGTGGG - Intronic
917119753 1:171635107-171635129 AGCAAACTGAAGTGGAGTTAGGG + Intergenic
917152489 1:171959875-171959897 AGCCAACTGAAGTGGGGAGAGGG + Intronic
917211238 1:172633950-172633972 AGGAAAGACAAATGCAGAGAGGG + Intergenic
917931534 1:179826067-179826089 AGGAGACCAAAGTGGAGAGAAGG + Intergenic
917951079 1:180037507-180037529 AGCAAACAAAAATCCAGAGATGG + Intronic
918241157 1:182621826-182621848 ACCAAACACAGATGGAGAGGTGG + Intergenic
918262635 1:182809595-182809617 CCCACACACAGGTGGAGAGAAGG + Intronic
918473550 1:184899694-184899716 AACAAGTAGAAGTGGAGAGAGGG - Intronic
920670913 1:208003090-208003112 AGCAGGGAAAAGTGGAGAGAGGG + Intergenic
920952112 1:210582251-210582273 ACCAAAGCCAAGTGGGGAGAAGG + Intronic
921107204 1:211994096-211994118 AGGAAAGACAAAAGGAGAGAAGG + Intronic
921107206 1:211994116-211994138 AGGAAAGACAAAAGGAGAGAAGG + Intronic
921794249 1:219324483-219324505 AGGAAACACGAGTGCAGAGGGGG - Intergenic
922979863 1:229816635-229816657 AACAAACACCATTGCAGAGAAGG + Intergenic
923212654 1:231818745-231818767 AGCAAACACAGGTTGAGACAGGG - Exonic
923727224 1:236517108-236517130 AACACACAAAAGTAGAGAGATGG - Intergenic
1062970984 10:1649141-1649163 ACCAAACATAAATGGAAAGATGG - Intronic
1063096904 10:2916170-2916192 AGTAACCAGAAGTGGAGACAGGG - Intergenic
1064271061 10:13866468-13866490 AGGAAACTGAAGTGGAGAGAAGG - Intronic
1065085712 10:22173855-22173877 AGAAAACACTAATGGAGAGCAGG + Intergenic
1065358029 10:24861584-24861606 AGCAAACAGAGGTGAAGTGATGG - Intronic
1067715092 10:48684815-48684837 AGAAAGCAGAAGTGGAGAGCCGG - Intergenic
1067877747 10:50020078-50020100 CACAAACACAAGTGGAGTGAGGG - Intergenic
1067877765 10:50020145-50020167 CACAAACACAAGTGGAGTGAGGG - Intergenic
1068501881 10:57849915-57849937 TGCAAACACATGTGGACAGTAGG - Intergenic
1070335406 10:75450515-75450537 ATTAAACACAATTGGAGGGAGGG + Intronic
1070355364 10:75634794-75634816 AGCAAACAAAAATGGAGGGGAGG + Intronic
1071082357 10:81827366-81827388 AGCCAAAGCAAGTGGAGGGATGG + Intergenic
1073223693 10:101897864-101897886 AGCAAAATGAAGTGGATAGATGG + Intronic
1073473295 10:103737129-103737151 TGAAAAGCCAAGTGGAGAGAGGG + Intronic
1073538667 10:104300438-104300460 AACCAAGATAAGTGGAGAGATGG - Intronic
1074403512 10:113161816-113161838 AGCACACATTAGAGGAGAGAGGG + Intronic
1074779537 10:116791156-116791178 AGCACACACTTGTGGAGGGAGGG - Intergenic
1075120814 10:119663270-119663292 ACCAAAAACAAATGAAGAGAAGG - Intronic
1078075281 11:8153820-8153842 AGGAAATACAAGAGGAGAGCAGG - Intronic
1078728496 11:13954629-13954651 AGCAAACAGAACTGGAAATAGGG - Intergenic
1079168705 11:18071210-18071232 AGGAAAAACAGCTGGAGAGAGGG + Intronic
1079558059 11:21786068-21786090 ACCAAACAAAAGTGGACAAATGG - Intergenic
1080673754 11:34405604-34405626 GGGAGACAGAAGTGGAGAGATGG - Intergenic
1080673783 11:34405742-34405764 GGGAAACAGAAGTGGAGAGATGG - Intergenic
1080673797 11:34405796-34405818 GGGAAAGAGAAGTGGAGAGATGG - Intergenic
1081290019 11:41313210-41313232 AGGAAGGAGAAGTGGAGAGATGG - Intronic
1081372872 11:42325494-42325516 AGAATACACTAGTAGAGAGAAGG + Intergenic
1081658738 11:44874906-44874928 AACAGACATAACTGGAGAGAAGG + Intronic
1083328852 11:61887570-61887592 AGCAGAGAGCAGTGGAGAGAGGG - Intronic
1084566712 11:69932754-69932776 AGGAAACAGAAGTGGACAGGAGG + Intergenic
1084658565 11:70533861-70533883 AGCAGACACAAAAGGAGACATGG - Intronic
1085636413 11:78162806-78162828 AGTAAACAAAAGTGCAAAGAGGG + Intergenic
1086414658 11:86576645-86576667 AGCAAACCAGAGAGGAGAGAAGG - Intronic
1087594711 11:100238096-100238118 AGCAAAAAGTAGTGGAGAAAAGG + Intronic
1088670256 11:112133555-112133577 AGCAAGCACAAAGGGAGAGGAGG - Intronic
1088789730 11:113213953-113213975 AGCAAAAACATATGAAGAGATGG - Intronic
1089030269 11:115319445-115319467 AGTAGAAAGAAGTGGAGAGATGG - Intronic
1089391323 11:118103949-118103971 AGCAAACACTAATGAATAGAAGG - Intronic
1089419505 11:118320554-118320576 AGAAAAGAAAAGTGGAGACAAGG - Intergenic
1089689809 11:120180380-120180402 TGCATTCCCAAGTGGAGAGAGGG - Intronic
1091603616 12:1932613-1932635 AGTGAGCAGAAGTGGAGAGAAGG + Intergenic
1091626982 12:2128877-2128899 AGCACACACAAGCTCAGAGAAGG + Intronic
1092873426 12:12827499-12827521 AGCAAACTAAGGTGCAGAGATGG + Intronic
1093569296 12:20647789-20647811 ATGAAAGACAAGTGGAAAGAAGG - Intronic
1093727689 12:22533669-22533691 AGGAAGCACAAGTGGGAAGAAGG + Intronic
1093901874 12:24644798-24644820 AGCAACCAGAAGTAGAGAAAAGG + Intergenic
1094167051 12:27453651-27453673 AGCAAAAACATCTGGAGGGATGG - Intergenic
1094415981 12:30215545-30215567 AGCATAGACAAGATGAGAGATGG - Intergenic
1094594245 12:31849437-31849459 AGCAGACAGAAGTGCAGATAAGG - Intergenic
1095376015 12:41529901-41529923 ACCAGTCAGAAGTGGAGAGAAGG - Intronic
1095799295 12:46255738-46255760 AGCACACAGAAGTGCAGATAAGG + Intronic
1096352973 12:50915789-50915811 AGAAAACCCAAATGGAGAGGAGG - Intergenic
1098023311 12:66177127-66177149 AGCAAACACAAATGAAAAGGAGG - Intergenic
1098444276 12:70550360-70550382 AGCAAATACGATTGGAGACAAGG + Intronic
1098458640 12:70706072-70706094 AGGAGACAAAAGTGGAGAAATGG + Intronic
1098469924 12:70831658-70831680 AGCAAGCACATGAGGACAGATGG + Intronic
1098828321 12:75328239-75328261 AACAAACCCAAGTTGAGATAAGG + Intronic
1099004954 12:77224807-77224829 AGCAAAAACAAGTGGAGTGGGGG + Intergenic
1100087753 12:90932185-90932207 AGCAAACAAAAGCGTAGAGTGGG - Intronic
1101101313 12:101396354-101396376 AGCACACACAAATGCACAGATGG + Intronic
1102607098 12:114076347-114076369 CGGAAAGACAAGTGGAGGGAGGG + Intergenic
1105425419 13:20290796-20290818 AACAAAAACTAGTGGAGACATGG + Intergenic
1107971011 13:45642149-45642171 AGCAGACAGAAGTGCAGATAAGG - Intergenic
1108570388 13:51743907-51743929 AGGAAATACAAGTGGACAGAGGG + Intronic
1108625974 13:52229062-52229084 AGCAAAGAGAACAGGAGAGATGG + Intergenic
1108660092 13:52577418-52577440 AGCAAAGAGAACAGGAGAGATGG - Intergenic
1108808373 13:54187655-54187677 AGAAAACAGAAGAGAAGAGAAGG + Intergenic
1109708635 13:66134059-66134081 AGCAAAGAGAAGTGGAGAGTTGG + Intergenic
1110564373 13:76943220-76943242 ATAAAACTCAAGTGGAGACAAGG + Intergenic
1111845568 13:93504405-93504427 ATCATACAGAAGTGGGGAGAAGG - Intronic
1112334970 13:98507192-98507214 AGAACACACCACTGGAGAGAGGG + Intronic
1112388792 13:98964044-98964066 AGTAAATACCTGTGGAGAGAGGG - Intronic
1112489633 13:99849870-99849892 AGAAAACTCCAGTGGAAAGAAGG - Intronic
1112915652 13:104547220-104547242 AGTAAAGACAAGTGGAGACTGGG - Intergenic
1112988267 13:105479138-105479160 AGCAACCTCAAATGGAAAGATGG - Intronic
1113038524 13:106078465-106078487 AGCAAACACGATTGGATGGAAGG + Intergenic
1114392643 14:22326737-22326759 AGAATACACGAGAGGAGAGAGGG + Intergenic
1114547819 14:23515111-23515133 AGCAAAAGGAGGTGGAGAGAGGG + Intergenic
1116118052 14:40682495-40682517 AGCAGTCACAGGTGGAGAGAAGG - Intergenic
1116841727 14:49825254-49825276 ATGGAACACAAGTGGAAAGAGGG + Intronic
1117108248 14:52420926-52420948 AGCAACCCCAAGTCAAGAGATGG + Intergenic
1117416727 14:55503315-55503337 AGCCCACACAAGTGGGGAGCAGG + Intergenic
1117983383 14:61363784-61363806 ACCAGACAGAAGTGGAGGGATGG + Intronic
1118088956 14:62451088-62451110 AGCAAACAGAAGTGCAGAAGTGG + Intergenic
1118403697 14:65402667-65402689 AGCAAAAAAAATTGTAGAGATGG + Intergenic
1118490614 14:66255681-66255703 ACAAAACGCAGGTGGAGAGAAGG + Intergenic
1119115889 14:72021139-72021161 AGAAAAGAAAAGTGAAGAGAAGG - Intronic
1120473184 14:84952543-84952565 AATAAAAGCAAGTGGAGAGATGG - Intergenic
1121452109 14:94015474-94015496 AGCCAACCCAAGTCAAGAGATGG - Intergenic
1124059274 15:26274052-26274074 GGGAAACACAAGTGAAGAAAAGG - Intergenic
1126118832 15:45233146-45233168 AGCTAACACAAGAACAGAGAAGG + Intergenic
1127552959 15:60059341-60059363 AAGAAACACAAGTGGGGAAAAGG - Intronic
1127919032 15:63478646-63478668 AGCCAACCAAGGTGGAGAGATGG - Intergenic
1128250414 15:66160007-66160029 AGCAAAGAAAAATGGGGAGAGGG - Intronic
1128687885 15:69700361-69700383 AGAAACCCCAAGTGGAGGGAAGG - Intergenic
1128930036 15:71696282-71696304 AGCAGACCCATGTGCAGAGAGGG + Intronic
1129182441 15:73885679-73885701 AGCAAGCACATGTGCAGGGATGG - Intronic
1130265254 15:82395510-82395532 AGCAAACAAAAGTGGAGGTTGGG - Intergenic
1130327913 15:82896270-82896292 AGGAAAGCAAAGTGGAGAGATGG + Intronic
1130506756 15:84551378-84551400 AGCAAACAAAAGTGGAGGTCAGG + Intergenic
1131651057 15:94400125-94400147 AGGAGAAATAAGTGGAGAGATGG - Intronic
1134744493 16:16577308-16577330 AACAAAAACATGTGGAGGGAGGG - Intergenic
1135000994 16:18776444-18776466 AACAAAAACATGTGGAGGGAGGG + Intergenic
1135387373 16:22055091-22055113 CTCAAAAACAAATGGAGAGAAGG - Intronic
1135793756 16:25422385-25422407 AGGAAGCACAAGTGAAGAAATGG + Intergenic
1135859911 16:26046539-26046561 AGCAATCAGAAGTGAAGTGAAGG - Intronic
1137038326 16:35586726-35586748 AGCAAACACGATTAGAAAGAAGG - Intergenic
1138683861 16:58707423-58707445 AGCAAAGAATAGTGGAGAGTAGG - Exonic
1139049071 16:63100511-63100533 AGCAAAAACAAGTGGTTACAGGG + Intergenic
1139278726 16:65751321-65751343 AGCAGACACACATGGAGACAGGG + Intergenic
1141178758 16:81738315-81738337 AGGAAATACAGGTGGGGAGAGGG - Intergenic
1141802728 16:86322246-86322268 ATGAAACCCAAGTGAAGAGATGG - Intergenic
1142233415 16:88910359-88910381 AGCATCCACAAGAGAAGAGAAGG - Intronic
1143956603 17:10674996-10675018 AGCAAACTGAAGGGGAGAGTGGG - Exonic
1145676218 17:26522752-26522774 AGAAAATGCAAGTGGAGATATGG + Intergenic
1147439691 17:40440435-40440457 AGCAAGCCCAAGAGGAGAAAAGG - Intergenic
1148392010 17:47279496-47279518 AGCAACCACAAAGGGAGGGAGGG + Intronic
1149225158 17:54461828-54461850 AGAAAACACAATTGGAATGAAGG + Intergenic
1150553997 17:66237264-66237286 AGCAAACAAAGGTGGAGAGTGGG + Intronic
1151427499 17:74040570-74040592 AGCACTCACCAGTGGAGAGGAGG + Intergenic
1153512020 18:5865246-5865268 AGCAGACAAAAGTGCAGATAAGG - Intergenic
1153684407 18:7530803-7530825 AGTAAATGCAACTGGAGAGAAGG + Intergenic
1153693533 18:7616980-7617002 ATCAAACAGAAGTACAGAGAGGG + Intronic
1157048469 18:44131851-44131873 AGCACAGACAGGTAGAGAGATGG + Intergenic
1157598920 18:48880957-48880979 AGCATCTCCAAGTGGAGAGATGG + Intergenic
1158053737 18:53255170-53255192 ATCCAAGACAAGTGGACAGAAGG - Intronic
1158870495 18:61682760-61682782 AGCAAACAAAAGTGGAGGGCAGG - Intergenic
1159227176 18:65554807-65554829 AGGAAGTACAAGTGTAGAGATGG + Intergenic
1160323356 18:77917028-77917050 AGCAAACAGAAGTCTAGAAATGG + Intergenic
1161202398 19:3022953-3022975 TGCAAAAACAAGTGGAGGGGTGG + Intronic
1163208985 19:15826435-15826457 AGCAAACAAGATTAGAGAGAAGG - Intergenic
1163637443 19:18443831-18443853 AGGACCCACAAGTGGACAGAGGG + Exonic
1164235915 19:23334017-23334039 AGCAAGAACAAGTGGAGAACTGG + Intronic
1164299019 19:23942822-23942844 AGGACTCAAAAGTGGAGAGATGG - Intronic
1164321861 19:24155739-24155761 AGCAAGAACAAGTGGAGAACTGG - Intergenic
1165843116 19:38801295-38801317 GGGATACACGAGTGGAGAGATGG + Intergenic
1166300314 19:41908967-41908989 AGAAAAGACAAGAGAAGAGATGG - Intronic
1167271027 19:48506387-48506409 AATAAACACAGGTGGAGAGAAGG + Intronic
1167652699 19:50741703-50741725 AACAAACACAAACAGAGAGAGGG - Intergenic
925603589 2:5635193-5635215 AGCTAACAGAAGTGGGGAGGAGG + Intergenic
925663166 2:6224274-6224296 AGGAAAAACAAGGGGAGACAGGG + Intergenic
925886194 2:8395279-8395301 AGAAAAAAGAAGGGGAGAGAAGG - Intergenic
925905417 2:8537078-8537100 AGCAAACACGAGGGGAGGGAGGG - Intergenic
927778734 2:25922571-25922593 AGAAAACAGAAGAGGAGAAAAGG + Intergenic
928280233 2:29939865-29939887 AGGAAACACCGGTGGAGGGATGG + Intergenic
928787558 2:34908067-34908089 AAAAAACACAAGTGGAAGGAAGG + Intergenic
928882353 2:36111993-36112015 AGCAAAGGCAAGTACAGAGATGG + Intergenic
931099970 2:58987021-58987043 AGCAAAAACAAGTATAGAAAAGG + Intergenic
931228654 2:60355303-60355325 AGCAAACCCAAATGGCCAGAAGG + Intergenic
931243148 2:60470407-60470429 GGCAAAAACAAGTGCAAAGATGG - Intronic
931478991 2:62621177-62621199 AGCATACACAAGTGGAAGAAAGG - Intergenic
932083443 2:68736516-68736538 TTCAAACATAGGTGGAGAGAAGG - Intronic
932455843 2:71849546-71849568 AGGAAAAACCACTGGAGAGAAGG + Intergenic
935341329 2:102062178-102062200 AGCAAGCTCATGAGGAGAGATGG - Intergenic
936042121 2:109158090-109158112 AGCAAACAGAGGTGGCAAGAGGG + Intronic
936496209 2:113023984-113024006 AGGAAACTGAAGTGGAGGGAAGG + Intronic
937755140 2:125527905-125527927 AGGAAACAGAAAGGGAGAGATGG - Intergenic
938906747 2:135843903-135843925 AGCTGACAGGAGTGGAGAGAAGG + Intronic
939629345 2:144515375-144515397 AGGAAACACAAGAGAGGAGAGGG + Intronic
939990236 2:148871521-148871543 AACAAACACCTGGGGAGAGAGGG + Intergenic
940604021 2:155897217-155897239 AGAAAACACAGATGGTGAGAGGG + Intergenic
941642582 2:168004970-168004992 AGCAAGCACTAGGGGACAGAAGG + Intronic
941765610 2:169293261-169293283 AAAAAACATAAGTGGAGAGGTGG + Intronic
943580559 2:189678690-189678712 AGCAAACACAAATGTAAAGTGGG - Intronic
944352772 2:198748326-198748348 AGCAATAAGAAGGGGAGAGAAGG + Intergenic
944405271 2:199377011-199377033 ACCAATCTCATGTGGAGAGAAGG + Intronic
944529641 2:200654783-200654805 AACAAGCACAACTGGAGAGCTGG - Intronic
945682569 2:212931856-212931878 AAAAAGCACAAGTGAAGAGATGG - Intergenic
946117273 2:217474141-217474163 AGTAAATACATGTGGAAAGAAGG + Intronic
947198676 2:227595642-227595664 AGCAAATACCCGTGGAGTGAGGG + Intergenic
948495813 2:238349121-238349143 TGAAAATACAAGTGGAAAGATGG + Intronic
948515663 2:238502022-238502044 AAGAAACACAAGTGTAGATATGG + Intergenic
948696135 2:239733804-239733826 AGCAAACACGGATGGAGAGAAGG + Intergenic
949070103 2:242019341-242019363 AGTAAACCCCAGTGGTGAGAGGG + Intergenic
1169276180 20:4235179-4235201 AGCAAACACGAGGGCACAGAAGG - Intronic
1170344586 20:15369701-15369723 TGCAAAAAGAAGTGGAGAGGAGG + Intronic
1170379715 20:15743681-15743703 CTCAAACACAAGTGCAGCGAGGG - Intronic
1170407652 20:16055695-16055717 GGCAAACACAAGTAGGGAAAAGG - Intergenic
1170861420 20:20107307-20107329 AGCAAAATGCAGTGGAGAGAAGG - Intronic
1171269776 20:23805352-23805374 AACAAGTACAAGTGAAGAGAAGG + Intergenic
1172627261 20:36354466-36354488 AGCAACTACAAATGGACAGAGGG - Intronic
1172816753 20:37693331-37693353 AGCAGACACAAGCCTAGAGAGGG + Intergenic
1173010907 20:39181202-39181224 AGAAAAGACATGGGGAGAGATGG - Intergenic
1173130901 20:40392349-40392371 AGAAAACAAAAGTGGGGAGAAGG + Intergenic
1173289286 20:41700412-41700434 AGAAAACACAGGGTGAGAGAAGG - Intergenic
1173444141 20:43102809-43102831 AGAAACCACAGCTGGAGAGAGGG - Intronic
1173911178 20:46672101-46672123 AGCCAACTCATGTGAAGAGAAGG + Intronic
1174414730 20:50359172-50359194 GGCAGAGACAAGTGGAGAGATGG - Intergenic
1175815936 20:61883255-61883277 AGAAAACACAGCAGGAGAGAGGG - Intronic
1177365919 21:20135784-20135806 AGCAAAGAGAAGTGGAAAGATGG + Intergenic
1179269199 21:39836756-39836778 AGCATCCACAAGTGAAGAGATGG + Intergenic
1181901527 22:26160185-26160207 AGGAAAGAGAAGAGGAGAGAGGG + Intergenic
1181911278 22:26240222-26240244 GTCAAACACAAGAGGAGAGAGGG - Intronic
1183966944 22:41447677-41447699 AGCAAACAAGAGTTGGGAGAGGG - Intergenic
1184930718 22:47679127-47679149 AGCCAACACTGGTGGAGAGGAGG + Intergenic
949113390 3:290518-290540 AGCAAACAGAAATCAAGAGATGG - Intronic
949525163 3:4896126-4896148 TGCAAAAACAAGTGGTGAGCAGG - Intergenic
949691688 3:6647495-6647517 AGGAAACACAATTGGTGTGAAGG + Intergenic
949699445 3:6739351-6739373 AGCAAACACAAGCCAGGAGAAGG - Intergenic
949849522 3:8408807-8408829 AGGAAACAGAAGTATAGAGAAGG - Intergenic
950457698 3:13102476-13102498 AGCAAACAGAAGCTCAGAGAAGG - Intergenic
952087374 3:29841666-29841688 AGTAAACAGAGGTGGAGAAAAGG - Intronic
953196461 3:40738867-40738889 AGGAAACACTAGAGGAGAGTGGG + Intergenic
953242988 3:41166146-41166168 AGCAAAGACATGAGAAGAGAAGG - Intergenic
953254214 3:41273862-41273884 AGCAGACATATGTGAAGAGAGGG - Intronic
953416291 3:42720422-42720444 AGCAAACAGAAGTGCAGATAAGG - Intronic
953740605 3:45535571-45535593 AGATAACACAATTGTAGAGATGG + Intronic
954270349 3:49503096-49503118 TGCAAACATATATGGAGAGATGG - Intronic
954789215 3:53118647-53118669 AGCAAACAAGCATGGAGAGAAGG + Intronic
954893490 3:53954749-53954771 GGTAAACAGAAGTGGAGAGAAGG + Intergenic
955497442 3:59549378-59549400 AGCAAATGCAAGTGCAGAAAAGG - Intergenic
956034787 3:65079278-65079300 TGCAACCACAAGAGGAGACAAGG - Intergenic
957065830 3:75521440-75521462 AGAACACATAAATGGAGAGAGGG - Intergenic
957500372 3:81048991-81049013 AGCAAGCACAAGTAGACACATGG + Intergenic
958863558 3:99472875-99472897 AGAAAAAACAAGTGGAGGGTTGG - Intergenic
959003159 3:100988527-100988549 TACAAACACAAGTTGAGACAAGG - Intronic
959662768 3:108887836-108887858 AGCAAAGACAAATGGAAAAAAGG + Intergenic
959850607 3:111082395-111082417 AGAAGAAAAAAGTGGAGAGAGGG + Intronic
960721854 3:120632199-120632221 AGCAAACTGCAGTGGACAGACGG + Intronic
961000204 3:123368977-123368999 ATCAAACACAAGGTGGGAGATGG + Intronic
961102436 3:124211787-124211809 TGGCAACACAAGTGGAGAGGAGG + Intronic
961673602 3:128551617-128551639 AGCAAACACCACAGGACAGAGGG + Intergenic
961797634 3:129421235-129421257 AGCAAACAGAAGTCTTGAGAGGG - Intronic
962511265 3:136102886-136102908 AGAAAGCACATGAGGAGAGATGG + Intronic
962676896 3:137764382-137764404 TGGAAACGCAAGAGGAGAGAAGG + Exonic
962715940 3:138126098-138126120 AGCAAACGCAAGTTGGGAGTCGG + Intronic
962804082 3:138914912-138914934 AGCAGACAGGTGTGGAGAGAGGG + Intergenic
963600718 3:147376788-147376810 AGAAAAGAGAAATGGAGAGAAGG - Intergenic
963619617 3:147589450-147589472 AGAAGATACAATTGGAGAGAAGG + Intergenic
964183473 3:153914645-153914667 AGCCTACAGAAGTGTAGAGATGG + Intergenic
964349907 3:155791976-155791998 AGCAAACACAGGTAGTGACAAGG + Intronic
964520512 3:157562009-157562031 AACAAACAGTAGTGTAGAGAAGG - Intronic
964646863 3:158967871-158967893 AGGAGACACAAGGAGAGAGAGGG + Intronic
964758057 3:160106549-160106571 ATCAATGACAAGTGGAGAGAAGG + Intergenic
965250332 3:166334957-166334979 AACAAACTCAAGTGAAGATATGG + Intergenic
966070955 3:175877409-175877431 AGCAAACACTAGTGGAGACCTGG + Intergenic
966548412 3:181178088-181178110 AGAACCCAAAAGTGGAGAGAAGG + Intergenic
969040382 4:4290713-4290735 AGGAAACAGAAGCCGAGAGATGG - Intronic
969074060 4:4563398-4563420 AGCAGAAGCAAGTGGAGACAAGG + Intergenic
969207521 4:5657933-5657955 AGCAAGCACAAGAGGTGGGAAGG - Intronic
970269928 4:14335152-14335174 AGGAAATACAAGAGGAAAGAGGG + Intergenic
970297890 4:14650758-14650780 AGCAAAAGTAAGTAGAGAGAGGG + Intergenic
971333825 4:25704519-25704541 AGAAAGCAGAAGGGGAGAGAGGG + Intergenic
971933271 4:33113944-33113966 AGCAAACAGCAGCAGAGAGATGG - Intergenic
972378591 4:38497805-38497827 AGCAAAGAAAAATGGGGAGAAGG + Intergenic
972463791 4:39332301-39332323 AGCAAAGAAGAGTGGAGAGGAGG - Intronic
972636777 4:40891268-40891290 AGCCAACACAGGTGGGGAGATGG - Intronic
973123423 4:46552930-46552952 AGGAAACCCATGTGGAGATAGGG + Intergenic
973860834 4:55063061-55063083 ATCAAACAAAAGTAGGGAGAAGG - Intergenic
975178831 4:71319882-71319904 AGTAATCACAGGTGGAGTGATGG - Intronic
975610528 4:76198281-76198303 AGCAAACATAAATGAACAGATGG + Intronic
976455792 4:85245921-85245943 AAGAAAAACAAGTGGAGAGAAGG - Intergenic
976930259 4:90558958-90558980 AGCAAAAACAAATGTAGACAAGG + Intronic
979000227 4:115208268-115208290 AGCAAACACAAATGTAAAGTGGG + Intergenic
981667712 4:147248336-147248358 AGCAAACAGAAGTGGATGGAGGG - Intergenic
982120264 4:152136606-152136628 AGAAAAAACAAGTGGAATGATGG + Intergenic
982391703 4:154871647-154871669 AAAAAACACAAATGGAGGGAAGG + Intergenic
982411520 4:155082873-155082895 AGCCAAGACAAGTGGAGAACTGG - Intergenic
983565942 4:169152152-169152174 AGCTTACACAAGTGAAGAAAGGG + Intronic
983574976 4:169251150-169251172 GGGAGACACAAGTGGACAGAAGG + Intronic
984344682 4:178507417-178507439 ACAAAAAACAAGTGAAGAGATGG + Intergenic
984839493 4:184054904-184054926 ATCAAACACAAGTTCAGACAAGG - Intergenic
986198404 5:5559174-5559196 AACAAACTGGAGTGGAGAGAGGG + Intergenic
988176645 5:27735116-27735138 AGCAAAGATAAGTAAAGAGATGG + Intergenic
988350061 5:30092132-30092154 GGCAACCAAAAGTGGAGAAAAGG - Intergenic
989245323 5:39248251-39248273 AGCAAAGACAAATGCAGACAAGG + Intronic
989383138 5:40828895-40828917 TGGAGACAGAAGTGGAGAGAGGG - Exonic
989669986 5:43905531-43905553 AGCAGACACAGGAGGAGAAAGGG - Intergenic
990302252 5:54460482-54460504 AGGAAAATCAAGGGGAGAGAGGG + Intergenic
990729013 5:58787888-58787910 AGCCAACAACAGTGGAGGGAGGG - Intronic
991658383 5:68926208-68926230 AGAAAACACAATTGGACAAAGGG + Intergenic
993470645 5:88303565-88303587 AGCAAAAACTTATGGAGAGATGG - Intergenic
995024102 5:107398930-107398952 AGGACACAAAAGTGAAGAGAGGG + Intronic
996790054 5:127282717-127282739 AGCACAGAAAAGTGGGGAGAGGG - Intergenic
996856836 5:128017668-128017690 AGCAAGCACAAGGTGAGAAAAGG - Intergenic
996859961 5:128054221-128054243 AGAATAGACAAGTGAAGAGATGG - Intergenic
997036228 5:130195180-130195202 AGAAGACATAAATGGAGAGAAGG - Intergenic
998306959 5:141087905-141087927 AGCAAACAGAAGAGAAGACATGG - Intergenic
998429832 5:142061323-142061345 AGCAAACACAGGAGGTGGGATGG - Intergenic
998917016 5:147024926-147024948 AGCAAACCAAAGTGAAGAAAAGG + Intronic
998923655 5:147098711-147098733 GGCAAACTGAAGTGGACAGATGG + Intergenic
998934319 5:147217467-147217489 AGGAAACAAAACTGGACAGAGGG + Intergenic
999032835 5:148313499-148313521 GGCAAACACACATGGAGAAATGG + Intronic
1000118613 5:158176000-158176022 AGAAGACACAAGTGAAGGGAGGG + Intergenic
1001003959 5:168033190-168033212 AGCAAACACAAGTGCTAAAAAGG + Intronic
1002309042 5:178303459-178303481 AGCAAAAACAAGGGGGAAGATGG - Intronic
1004803090 6:19172622-19172644 AGCAAAGGCAAGCAGAGAGATGG + Intergenic
1006877229 6:37308376-37308398 AGCAAAAAGCAGTGGAGAAAGGG - Intronic
1007820285 6:44555836-44555858 GGCACAGACAAGTGGAGTGAGGG + Intergenic
1008232620 6:49002104-49002126 AGTAAAGAGAAGTGAAGAGAGGG - Intergenic
1010318318 6:74476038-74476060 AGTAAATACAATTAGAGAGAAGG - Intergenic
1011122655 6:83970670-83970692 ACCAGACACAACTGGAGACATGG - Intergenic
1011275081 6:85622731-85622753 AGCAAATACAAGTGGATCAAAGG + Intronic
1011583001 6:88892352-88892374 ACCAACCACCAATGGAGAGAAGG + Intronic
1011659606 6:89582947-89582969 AGCTGACTCAGGTGGAGAGATGG - Intronic
1013399052 6:109773436-109773458 AGAAAAAACAAGTAGAGAAACGG - Intronic
1014312600 6:119822944-119822966 AGCAGCCATGAGTGGAGAGATGG - Intergenic
1014698120 6:124650142-124650164 AGCTAACACAAGACAAGAGAAGG + Intronic
1014793229 6:125699014-125699036 AGCAAACAAAAGTCATGAGATGG + Intergenic
1015903572 6:138092866-138092888 AGGAAACAGACGTGGAGGGAGGG + Intronic
1016402609 6:143696811-143696833 AGCAAACACAAGTGGAGAGAGGG - Intronic
1018472742 6:164111216-164111238 AGCAGCCACCAGTGGAAAGATGG - Intergenic
1018480825 6:164188217-164188239 AACAAACATAAGAGCAGAGATGG - Intergenic
1019245644 6:170707870-170707892 AGAAAACCCCAGTGGGGAGAAGG + Intergenic
1021765730 7:23947143-23947165 AACAAATAAAAGAGGAGAGAAGG + Intergenic
1022445463 7:30466925-30466947 ACCCAACACAAGTTGGGAGAAGG - Intronic
1023129293 7:36986657-36986679 ATCAAATAAAAGTAGAGAGAGGG - Intronic
1025255756 7:57383036-57383058 GGCAGAGACAGGTGGAGAGATGG + Intergenic
1028466907 7:91162658-91162680 AGGAACCAGAAGTGTAGAGAGGG - Intronic
1028930586 7:96408869-96408891 AACAACCACAAGGGGAGAGAAGG - Intergenic
1030385808 7:108866724-108866746 AGAAAACATAAATGCAGAGATGG + Intergenic
1030570990 7:111224101-111224123 AGTAAACCCAGGTTGAGAGAGGG - Intronic
1030998124 7:116383200-116383222 AGGAAAAAGAAGAGGAGAGAAGG + Intronic
1033002596 7:137523649-137523671 AACAAACACAATTTGAGTGATGG - Intronic
1033471228 7:141651412-141651434 AGCTTACATAAGTGGACAGATGG - Intronic
1033881166 7:145885975-145885997 AGGAAATTCAAGTGCAGAGATGG - Intergenic
1034112276 7:148548512-148548534 AGAAAACAGAAGTGGAGGAAGGG - Intergenic
1034272724 7:149811207-149811229 GGCTAACACAGGTGGGGAGAGGG - Intergenic
1035527994 8:328850-328872 ACCAAAGACAGGTGGAGAGCAGG + Intergenic
1036786139 8:11688834-11688856 AGCACAAACTGGTGGAGAGATGG + Intronic
1038948411 8:32387148-32387170 AGTAAATACAAGTAGAGATATGG + Intronic
1039385317 8:37130301-37130323 TAGAAAGACAAGTGGAGAGAAGG - Intergenic
1039479765 8:37863865-37863887 ACCAAACACCAGTGCAGAGCTGG + Intronic
1039860373 8:41452519-41452541 AGAAAACACATTTGAAGAGATGG - Intergenic
1041524019 8:58785803-58785825 TGCAAACAGAAAGGGAGAGAGGG - Intergenic
1041844124 8:62307441-62307463 AAAAAAGACAAGTGGAAAGAAGG - Intronic
1041845545 8:62323650-62323672 AGCATTGACAAATGGAGAGAGGG - Intronic
1042426054 8:68650283-68650305 AGCAAAAGGAAGAGGAGAGAGGG + Intronic
1043178981 8:77059898-77059920 AGCAAAAACAAAGGGAAAGAAGG + Intergenic
1043935195 8:86134421-86134443 AGAAAACTCAAGAGGAGAAAGGG - Intronic
1044289036 8:90446282-90446304 AGCAGAAATAAGTGGAGAGGTGG - Intergenic
1045154498 8:99452097-99452119 AGAAAATACAACTGGAGAGGTGG - Intronic
1045401686 8:101825386-101825408 AGGAAACCCAAATGGACAGAGGG + Intronic
1046761638 8:118027514-118027536 AGCAAGCACTTGTAGAGAGAGGG - Intronic
1047135427 8:122072602-122072624 AGTAAACAGAAGTTGAGGGAGGG - Intergenic
1047771531 8:128033898-128033920 AGCAAGCAAAAGTGTGGAGAGGG - Intergenic
1048646199 8:136422786-136422808 AGAAAACTGAAGTGGAGAGGGGG - Intergenic
1048811329 8:138289441-138289463 AGCAGACAGAAGTGGAGTGAGGG - Intronic
1048847764 8:138616367-138616389 AGCAAGCACAGGTGTAGAGAGGG - Intronic
1050132919 9:2431305-2431327 AAGAAATACAAGTGGAGAAATGG - Intergenic
1054831285 9:69627936-69627958 AGCATACACAGGAGGAGGGAGGG - Intronic
1055639700 9:78310093-78310115 AGCAGACACAAGGGAAGAGCTGG + Intronic
1055781839 9:79829102-79829124 AGCACAGACAGGTCGAGAGATGG + Intergenic
1057150618 9:92792988-92793010 ATCAATGACAAATGGAGAGAAGG + Intergenic
1058326198 9:103700977-103700999 AGCACAGAACAGTGGAGAGAAGG + Intergenic
1058755564 9:108080033-108080055 AGGAAACAGAAGCCGAGAGATGG + Intergenic
1058793393 9:108473137-108473159 ATCAAACACAAGAAAAGAGAGGG + Intergenic
1060670849 9:125467909-125467931 AGCACACAGAAGAGAAGAGAGGG + Intronic
1060813185 9:126621426-126621448 TGCAGTCAGAAGTGGAGAGACGG + Intronic
1061881937 9:133573082-133573104 TGCAAACAGAAGTGGAGAGTGGG + Intronic
1186119150 X:6339792-6339814 TACAAACACAAGTGGAGGGCTGG + Intergenic
1186597011 X:10993091-10993113 AGAAAACAGAAATGGAGGGATGG + Intergenic
1187185269 X:16978477-16978499 AGGAAACACAAGGGCACAGAAGG - Intronic
1187248470 X:17575118-17575140 AGCAAACACTAGTGGACGTAGGG - Intronic
1187977570 X:24718710-24718732 TGCACACACACGTGGAGGGATGG + Intronic
1189355752 X:40308772-40308794 AGGAAAAACACATGGAGAGAAGG - Intergenic
1191030380 X:55963234-55963256 AGCAAAGAATAGTGGAGAGTAGG + Intergenic
1192145833 X:68681828-68681850 TGCAACCACAGGTGGTGAGAGGG - Intronic
1192215348 X:69154101-69154123 AGCAAACCAAAGCTGAGAGAGGG + Intergenic
1195386799 X:104321229-104321251 CCCACACACAAGGGGAGAGAAGG - Intergenic
1196184258 X:112728425-112728447 AGCACACACAAGTGAGAAGAAGG + Intergenic
1196187176 X:112756918-112756940 AGAAAACACAAGAGAACAGAAGG - Intergenic
1196497791 X:116342398-116342420 AGCAACCACAAGTGACCAGAAGG + Intergenic
1196497869 X:116343492-116343514 AGCAACCACAAGTGACCAGAAGG + Intergenic
1198910452 X:141607390-141607412 AGCCACCCCAAGTGGAGGGAAGG + Intronic
1202328267 Y:23716660-23716682 CGCATACACAAGTGGTAAGAAGG + Intergenic
1202388018 Y:24343519-24343541 AGAAAACTCCGGTGGAGAGAAGG + Intergenic
1202482769 Y:25326609-25326631 AGAAAACTCCGGTGGAGAGAAGG - Intergenic
1202542504 Y:25953392-25953414 CGCATACACAAGTGGTAAGAAGG - Intergenic