ID: 1016403141

View in Genome Browser
Species Human (GRCh38)
Location 6:143701997-143702019
Sequence TAAGTAGCAGAGTTGGAACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 3, 2: 3, 3: 37, 4: 278}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016403133_1016403141 30 Left 1016403133 6:143701944-143701966 CCTAATTTCAGCAATGAAAAATT 0: 1
1: 0
2: 3
3: 70
4: 728
Right 1016403141 6:143701997-143702019 TAAGTAGCAGAGTTGGAACTAGG 0: 1
1: 3
2: 3
3: 37
4: 278
1016403139_1016403141 2 Left 1016403139 6:143701972-143701994 CCTAGCACAAGGTCACAGGGCTG 0: 1
1: 1
2: 3
3: 41
4: 376
Right 1016403141 6:143701997-143702019 TAAGTAGCAGAGTTGGAACTAGG 0: 1
1: 3
2: 3
3: 37
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016403141 Original CRISPR TAAGTAGCAGAGTTGGAACT AGG Intronic
901900569 1:12358345-12358367 TCAGTGGTAGAGATGGAACTTGG + Intronic
904119218 1:28185322-28185344 TAGGTAACAGAGCTGGAATTAGG + Intronic
904785558 1:32980063-32980085 GAAGTACCAGAAGTGGAACTTGG - Intergenic
905438540 1:37977273-37977295 TAAGTAGCAGAGTCAGGATTTGG - Intronic
906514397 1:46430343-46430365 TAAGTGGCAGAGCTGGACCCAGG - Intergenic
907420321 1:54342643-54342665 TGAGCAGCAGAGATTGAACTTGG - Intronic
907496494 1:54848632-54848654 TAAGATTCAGATTTGGAACTGGG + Intergenic
907736221 1:57115221-57115243 TAAGTAGCAGAGCTGGGATTAGG - Intronic
907820302 1:57960974-57960996 TAAGTAGCTGAGCTGGAATTTGG - Intronic
907850770 1:58252724-58252746 GAAGTAGCAGAGCTGGAACTTGG + Intronic
907895554 1:58686784-58686806 TTAGTAGAAGAGTAGGGACTTGG + Intronic
910053214 1:83000899-83000921 TGACTAGTAGATTTGGAACTGGG + Intergenic
910656750 1:89627690-89627712 TGAGTAGAAGAGTTGGGATTTGG - Intergenic
910729889 1:90383681-90383703 TAAGAAGCACACTTGGAAATTGG + Intergenic
911119217 1:94278401-94278423 TAAGTAGTAGAATTAGAATTGGG - Intergenic
913691666 1:121285446-121285468 TAAATAGTAGAGCTGGAATTGGG + Intronic
914145880 1:144994509-144994531 TAAATAGTAGAGCTGGAATTGGG - Intronic
915189306 1:154135307-154135329 AAAGGAGTATAGTTGGAACTTGG - Intronic
916481785 1:165220848-165220870 TTAGTAGCAAAATTAGAACTAGG - Intronic
916790102 1:168117448-168117470 TAAGTAGCAGAGCTGGGATTTGG - Intronic
917451218 1:175149253-175149275 TGAGGAGAAGACTTGGAACTGGG - Intergenic
917601473 1:176578479-176578501 TCAGGAGCAGAGTGGGAACAAGG + Intronic
918232717 1:182550678-182550700 TAAGTGGCAGGGTGGAAACTAGG + Intronic
921247568 1:213260572-213260594 TAAGTAGTTAGGTTGGAACTTGG - Intronic
921300593 1:213748056-213748078 TAAAGAGCAGAGATGGATCTAGG - Intergenic
921621910 1:217334597-217334619 TAATTACCTGAGTTGGAACTTGG - Intergenic
923719462 1:236454692-236454714 TGAGTAGCAGAGTTGGCCCGGGG + Intronic
1065878328 10:30016908-30016930 AAAGTAGCAGAGTTGTCAGTGGG + Exonic
1067258358 10:44664985-44665007 TAACTGGCAGAGTGGGAGCTGGG - Intergenic
1068129539 10:52880451-52880473 TAAGTAGCAGAGCTGGAATTTGG - Intergenic
1068379187 10:56226931-56226953 TAATTTCCAGTGTTGGAACTGGG - Intergenic
1068618609 10:59151605-59151627 TAATTGGCAGAGCTGGAATTTGG + Intergenic
1068887407 10:62111707-62111729 TGAGTTGCAGAGCTGGGACTTGG + Intergenic
1069205077 10:65671608-65671630 CAAGTAACAGAGTTGGAATGAGG + Intergenic
1069735868 10:70653820-70653842 TAAGTGGCAGAGTTGGGATGTGG - Intergenic
1070495791 10:77020837-77020859 TAAGTGGTAGTGTTGGAATTTGG - Intronic
1070583914 10:77746728-77746750 TAAGAAGCAGAAATGGGACTGGG + Intergenic
1070607349 10:77908227-77908249 TAACTCTCAGAGTTGAAACTGGG + Intronic
1070627752 10:78063271-78063293 TAAGTAGCAAAGTAAGAAATAGG + Intergenic
1070913990 10:80141103-80141125 TCAGTAGCAGCGTTGACACTGGG - Intronic
1071666839 10:87566997-87567019 TGGGAAGCAGATTTGGAACTGGG + Intergenic
1072052354 10:91718191-91718213 TAAGTGGCAGAGCCAGAACTCGG - Intergenic
1073666258 10:105537545-105537567 CGAGTGGCAGAGTTGGAATTTGG + Intergenic
1074599676 10:114900949-114900971 TAAGTTGCACCCTTGGAACTGGG - Intergenic
1074829568 10:117239587-117239609 GAAGTAGCAGACTGGGACCTGGG + Intergenic
1075373376 10:121956685-121956707 GAAATAGCAAAGTGGGAACTGGG + Intergenic
1075877565 10:125820753-125820775 TAAGTGGGAGAGATGGAATTTGG + Intronic
1076224565 10:128763821-128763843 TAACTAGCACAGTTGGAGCCTGG + Intergenic
1077509455 11:2948990-2949012 CAAGTAGCAAAGATGTAACTTGG - Intronic
1078017531 11:7627804-7627826 TATGTAAAAGAGTTGGTACTTGG - Intronic
1078539244 11:12200094-12200116 TAAGTAGCAGGCCTGGTACTGGG + Intronic
1079972909 11:27058442-27058464 TTAGAAGCAGCTTTGGAACTGGG + Intronic
1080269486 11:30435807-30435829 TAAGTGGCAGAGCTGGGATTTGG + Intronic
1080421252 11:32112537-32112559 TAAGTGGCAGAGCTGGGATTTGG - Intergenic
1081565714 11:44259887-44259909 TCAGTAGCAGAGCCAGAACTGGG + Intergenic
1085192417 11:74639289-74639311 TAAGTAGCAGAGTAGGTATTGGG + Intronic
1085661798 11:78374479-78374501 TCAGTAGCAGAATTGGCACTAGG - Intronic
1085837949 11:79976411-79976433 TCAGTAGAAGAGCTGGAATTAGG + Intergenic
1086211150 11:84320814-84320836 TAACTAGCATAGTTGGATTTGGG + Intronic
1087542976 11:99544286-99544308 TAATTCGCAGTGTTGGAAGTCGG - Intronic
1088519814 11:110683831-110683853 TAAGTTGCAGCATTTGAACTTGG - Intronic
1090138513 11:124226760-124226782 TGAGTAGGAAAGTTTGAACTGGG - Intergenic
1090220488 11:125018553-125018575 TAGGTAGCAGAGCTGGGACTTGG - Intronic
1091141372 11:133237825-133237847 CCAGGTGCAGAGTTGGAACTAGG + Intronic
1091191022 11:133695337-133695359 TAAGCAGCAGAGCTGGGACCTGG - Intergenic
1091681581 12:2531367-2531389 TTAGTATCAGAGCTGGGACTAGG - Intronic
1092265685 12:6978579-6978601 TAAGTAGAAAAGTTGAAACAAGG - Intronic
1092548542 12:9472632-9472654 TAAGAAGCAGAATTGGAAACCGG - Intergenic
1093438580 12:19166071-19166093 TAAGTGGCAGAGTTGGGATCTGG + Intronic
1093645189 12:21578112-21578134 GAAGTACAAGAGTTGTAACTGGG - Intronic
1097118395 12:56716093-56716115 TAGGAGGCAGAGTGGGAACTGGG + Exonic
1097512776 12:60564889-60564911 TCAGTGGCAGTGTTGGAACCTGG + Intergenic
1097932951 12:65210645-65210667 TAAGTGGTAGAGGTGGAGCTGGG + Intronic
1099304216 12:80935490-80935512 TGAGTATCAGAGTTGCAGCTAGG + Intronic
1099815541 12:87642498-87642520 TAATTATCAGACTTGGAACAAGG - Intergenic
1100086459 12:90916335-90916357 TAAGTAGCAAAGTTATAATTGGG + Intronic
1100746119 12:97647883-97647905 TAAGCAGCAGAGTTGGAACTAGG - Intergenic
1100746149 12:97648401-97648423 TAAATAGCAGAGTTGGAACTAGG + Intergenic
1102426801 12:112850120-112850142 TAAGTGGCAGAACTGGAATTTGG - Intronic
1103185544 12:118953922-118953944 TAACTAGCCTAGTTGGAAATTGG - Intergenic
1103204919 12:119121121-119121143 TAAGAAGCAGAGGCGGATCTTGG + Intronic
1104533186 12:129592233-129592255 AAAATAGCTGACTTGGAACTGGG + Intronic
1104582226 12:130019286-130019308 TAAGGACCAGAGTGGGAAGTCGG + Intergenic
1105015083 12:132781772-132781794 TAAGTAGCTGAGTGAGAACCAGG + Intronic
1105478640 13:20752185-20752207 TAAATAGCAGTGGTGGAAGTGGG + Intronic
1106500083 13:30319801-30319823 TAAATAGCAGAATTGTAATTAGG - Intergenic
1107335572 13:39351383-39351405 TAAATAGCAAAGCTTGAACTCGG + Intronic
1108037567 13:46307439-46307461 TAAGTAGAACAGTTGGTACTAGG - Intergenic
1109215601 13:59586165-59586187 AGAGTGGCAGAGCTGGAACTAGG - Intergenic
1110134153 13:72044595-72044617 TAAGTAGGAGATTTGGGAATGGG + Intergenic
1110551695 13:76817979-76818001 TAAGTGGTGGAGTTGGAATTTGG - Intergenic
1111884347 13:94000567-94000589 CAAGTTGGACAGTTGGAACTGGG + Intronic
1112921508 13:104618471-104618493 GAAGTAGCAGAGTTGGGAGACGG + Intergenic
1113296790 13:108968274-108968296 TAAGAATCAGAGATGGAAATGGG - Intronic
1114412870 14:22517295-22517317 TCAGCAGCAGAGCTGGAATTGGG + Intergenic
1114538899 14:23440411-23440433 TAAGTAGCAAACGTGGCACTGGG + Intergenic
1115091591 14:29583288-29583310 TAAATAGCAGAGATGGAACAAGG + Intronic
1116643646 14:47498146-47498168 GAAGGAGCAGAGATGAAACTAGG + Intronic
1116850196 14:49901173-49901195 TAAGTAGCAGAGCCTGAATTTGG + Intergenic
1117870615 14:60197149-60197171 TAAGAACCAGAGTTGGAAAGTGG + Intergenic
1118535578 14:66759673-66759695 AAAGTAACAGAGTTGCAAGTTGG - Intronic
1119768328 14:77204881-77204903 TAAGTAGCAGAGGCAGAACTTGG + Intronic
1119784008 14:77298925-77298947 TAAGTGGCTGAGTTGGGATTTGG - Intronic
1120321443 14:82966765-82966787 TAAGTAGTAGAGTTGCAATCTGG - Intergenic
1120340862 14:83219571-83219593 TTAGAAGCAGCTTTGGAACTGGG + Intergenic
1120353711 14:83400396-83400418 TAAGTGGCACAGTTAAAACTGGG + Intergenic
1120725872 14:87940515-87940537 TTAGTGGCAGAACTGGAACTAGG - Intronic
1121259701 14:92557315-92557337 TAAATAGCAGAGTGGGAATCTGG + Intronic
1121667346 14:95683396-95683418 AAATAAGCAGAGCTGGAACTTGG + Intergenic
1122798734 14:104219433-104219455 TAAGCAGCAAAGCTGGAATTCGG + Intergenic
1122803353 14:104244058-104244080 TAAGTAGCAGATTAGTGACTAGG - Intergenic
1124838255 15:33216494-33216516 TGAGTAGCAGGCTAGGAACTGGG - Intergenic
1125038510 15:35155465-35155487 AAAGTACCAGAGATGGGACTAGG + Intergenic
1127063430 15:55212257-55212279 AAAGTAGCAGAGTTAGGATTTGG + Intronic
1127070573 15:55284763-55284785 TTAGTGGCAGAGCTGGAAGTGGG - Intronic
1127805675 15:62517851-62517873 TAAGTGGCAGAGCTGGGACATGG - Intronic
1127904355 15:63365417-63365439 TGAGGAGCAGAGTCAGAACTTGG - Intronic
1128552793 15:68609101-68609123 GAAGGAGCAGCATTGGAACTGGG + Intronic
1128634897 15:69296930-69296952 TCAGTAGCAGAGCTAGAACTTGG - Intergenic
1128712545 15:69883054-69883076 TGAGTATCAGAGGTGGAAATCGG - Intergenic
1129147163 15:73658903-73658925 CAAGGAGCAGAAGTGGAACTTGG - Intergenic
1129465683 15:75723027-75723049 AAAATAGCAGAGATGGAACCAGG - Intergenic
1129817997 15:78573033-78573055 TAAGCAGCAGAAGTAGAACTAGG - Intronic
1129859649 15:78850636-78850658 TAAATGGCAGAGCTGGAACTTGG - Intronic
1130189410 15:81718557-81718579 TAAGTAGCAGAATTGAAACGAGG + Intergenic
1131305178 15:91236498-91236520 GAAGTTGCAGAGTTGGGAGTGGG + Intronic
1131398050 15:92102558-92102580 TAAGTGGCAGAGCTGGGATTCGG + Intronic
1131538570 15:93257133-93257155 GAAGTAGCAGAGCTGGGGCTGGG - Intergenic
1131802663 15:96087546-96087568 TTAGTAGCAAAGTTGGAGTTGGG + Intergenic
1133412727 16:5581661-5581683 TAAGTTGCAGAATGGGAACAGGG + Intergenic
1133828585 16:9301204-9301226 TAAGTGGCAGAGTTGGAGTTTGG + Intergenic
1133846731 16:9461303-9461325 TAAGTGGCAGAGGTGGGAATTGG + Intergenic
1134070705 16:11257831-11257853 AAAGGTGCAGATTTGGAACTGGG - Intronic
1134211569 16:12281773-12281795 TAAGAAGCAGAGCTGGGGCTGGG + Intronic
1134679296 16:16112921-16112943 TAAGTGGCAGAGATGGGATTTGG + Intronic
1134792608 16:17003583-17003605 AAAGAACCAGAATTGGAACTTGG + Intergenic
1136481160 16:30542811-30542833 TAACTACAGGAGTTGGAACTGGG - Intronic
1137627133 16:49916314-49916336 TACGTGGCAGAGTGGGAACAAGG - Intergenic
1138184378 16:54964987-54965009 TAAGGAGCAGAGTTGCAAACTGG - Intergenic
1138858341 16:60722984-60723006 TAATTAGCAGAGATGGAAGCTGG - Intergenic
1140260993 16:73379443-73379465 TAAGTAGCAGAGGTGGAACTTGG - Intergenic
1140628933 16:76828767-76828789 TAATTAGGAGAATTGGAAATTGG - Intergenic
1141322153 16:83021236-83021258 TAAATAGCAGAACTGCAACTTGG - Intronic
1141760318 16:86024873-86024895 TAAGTGGCAGAGTGGGGATTGGG + Intergenic
1142267127 16:89069691-89069713 TAAGTGGCAGAGCAGGGACTCGG + Intergenic
1142546780 17:709721-709743 GAAGTAGCAGAGTTGGGAGAAGG - Intronic
1143075627 17:4340382-4340404 TTAGAAGGAGAGTTGGAACCGGG - Intronic
1144212541 17:13027398-13027420 TAAGCAGAAGAGTTGGAGCCTGG + Intergenic
1144758400 17:17693918-17693940 GAAGTGGCAGAGCTGGGACTCGG - Intronic
1147561689 17:41513235-41513257 TAAGTAGCAGGGCTGGGCCTGGG - Intergenic
1149194994 17:54108920-54108942 TAAGTAGCAGCATTGAGACTTGG - Intergenic
1149757731 17:59201580-59201602 AAAGTGGCAGAGTTGGAGTTGGG - Exonic
1151408376 17:73903984-73904006 CAAGTCTCAGAGTTGGCACTGGG - Intergenic
1152036531 17:77876657-77876679 TAAGTAGAAGGGCTGGGACTGGG - Intergenic
1153568537 18:6445087-6445109 TAAGTGGCAGGGGTGGAATTTGG - Intergenic
1155124492 18:22858407-22858429 TATTTATCAGAGTTGGAATTTGG + Intronic
1155835089 18:30571519-30571541 TAAGTAACTGAGTAGAAACTAGG + Intergenic
1157194335 18:45608446-45608468 TAAGTAGAAGAGCTGCAATTTGG + Intronic
1158164044 18:54518964-54518986 TAGGTTGCAGATTTGGAATTCGG - Intergenic
1158334377 18:56399593-56399615 TAAGTAGTAAAGTTGAGACTTGG - Intergenic
1161402976 19:4077101-4077123 TCAGTTGCAGAGAGGGAACTGGG - Intergenic
1165924060 19:39316058-39316080 TAAGTATCAGAGCTGGGATTTGG - Intergenic
1166083840 19:40462070-40462092 TAAGTGGCAGAGCTGGAGTTTGG - Intronic
927254860 2:21032242-21032264 TAAGGAGCAGAGTTTGAAAGTGG + Intronic
927399167 2:22690815-22690837 TAAGTAGCCAAGTTGGTATTTGG + Intergenic
927408426 2:22798058-22798080 TAAATACCAGAGTTGAAACTAGG - Intergenic
927624883 2:24705042-24705064 TAAGTATCAGAATTTTAACTAGG + Intronic
928224677 2:29438293-29438315 TAAGTATTAGAGTTTGAACCAGG + Intronic
928372041 2:30747292-30747314 TAAGTAGCAGAGCTGGGAATCGG + Intronic
928528368 2:32165160-32165182 GTAGTAGCAGAATTTGAACTCGG - Intergenic
929325945 2:40610780-40610802 GAAGAAGCAGATTTGGAACTGGG - Intronic
929539355 2:42808489-42808511 CAAGCAGCAGAGTTGGCCCTCGG - Intergenic
932208912 2:69910740-69910762 TATATAGCAGAGTAGGAAATTGG + Intronic
932580974 2:72992555-72992577 TGAGAAGCAGAGCTGGAAATGGG - Intronic
932620113 2:73260199-73260221 TAAGTAGCAGAGCCAGACCTGGG + Intronic
932739367 2:74280087-74280109 CATGTTGCAGTGTTGGAACTTGG - Intronic
932829794 2:74978088-74978110 TAAGTAGCAGATAAGAAACTAGG - Intergenic
933218755 2:79663155-79663177 TTAGCAGCAGAGTTGGAAAGTGG - Intronic
933282983 2:80353217-80353239 TAAATAGCAAAGTAGGTACTGGG + Intronic
937812311 2:126212683-126212705 TAAGAAGCAGAATTTGAACATGG + Intergenic
939015778 2:136902481-136902503 GGAGCAGCAGAGATGGAACTGGG + Intronic
941282328 2:163568513-163568535 TAAGTAGTAAAACTGGAACTTGG + Intergenic
941967977 2:171318878-171318900 TAAGTAGCAGAGTCACAACTCGG - Exonic
944141037 2:196457352-196457374 TAAGTACCAGAGCTGGAATTAGG + Intronic
944562580 2:200955739-200955761 GTACTAGGAGAGTTGGAACTGGG - Intronic
945095575 2:206215892-206215914 TAAGTGGCAGAGTTGGGGTTTGG + Intronic
946341402 2:219071588-219071610 ACAGTAGCAGAGTTAGAATTGGG - Intergenic
947034716 2:225838879-225838901 AAAATATCAGAGTTGGAAATTGG + Intergenic
1169484402 20:6014819-6014841 TAAGTATCAGAATTTTAACTAGG + Intronic
1170307984 20:14960617-14960639 AAAGTATCATAGTTGGATCTAGG - Intronic
1170366824 20:15607223-15607245 TTTGTAGCTGAGTTGAAACTAGG + Intronic
1170403004 20:16007913-16007935 TAAGTTTCACAGTTGGAACCTGG + Intronic
1170453291 20:16508277-16508299 TAAGCAGCAGAGCTGGGATTCGG - Intronic
1172123162 20:32610333-32610355 TAAGTAGAAGAGGTGGAAGGGGG + Intergenic
1173012625 20:39195961-39195983 GAAGTAGCACAGTGGGGACTAGG + Intergenic
1178294566 21:31398191-31398213 TTAGAACCAGAGTTGAAACTAGG + Intronic
1180669774 22:17543981-17544003 TAAGTAGCAGAGCTGAGATTTGG + Intronic
1182839299 22:33373649-33373671 ATAATAGCAGAGTTAGAACTGGG - Intronic
1183025554 22:35063528-35063550 TCAGAAGCAGAATTTGAACTGGG - Intergenic
949997023 3:9626222-9626244 GAAGCAGCAGTGTTGCAACTTGG + Intergenic
950861067 3:16148090-16148112 TGAGTGGCAGAGTTTGGACTGGG + Intergenic
953229811 3:41054798-41054820 TAAGTGGGAGAGTAGGAATTTGG + Intergenic
956104210 3:65800026-65800048 TAAGTGGTAGACTTGGAATTAGG - Intronic
956189803 3:66597678-66597700 TCAGTTGCAGAGTTTGGACTTGG + Intergenic
960619056 3:119621768-119621790 TAAGCAGCAGGGTTGGGCCTTGG + Intronic
963094928 3:141525990-141526012 TAAGTAACAGAATTGACACTAGG + Intronic
963611444 3:147473642-147473664 TAAGCAGCAGACTGGAAACTTGG - Intronic
963792503 3:149598440-149598462 TAAGTAAAAGAGTAGGAATTTGG + Intronic
964701867 3:159576709-159576731 TAAGTCGGGGAGTTGAAACTGGG - Intronic
965709558 3:171543701-171543723 TGAGTAGCAGAGTTGGAAGGGGG + Intergenic
965814502 3:172622672-172622694 TTACTGGCAGAGCTGGAACTGGG + Intergenic
966269412 3:178086537-178086559 TAGGTAGCACAGTTGGAATACGG + Intergenic
966486238 3:180474386-180474408 TAAGTGGTAGAATTGCAACTGGG - Intergenic
967380065 3:188847918-188847940 CATGAAGCAGAGCTGGAACTAGG + Intronic
968094309 3:195917273-195917295 ACAGTAGCAGAGTTGGAAGTTGG + Intergenic
968884594 4:3320933-3320955 GAAGCAGCAGAGTTGGCACAGGG + Intronic
969402856 4:6968543-6968565 TAAGTAGCACAGCTGGAAACCGG + Intronic
970703295 4:18769149-18769171 TAATTAGATGAGTTAGAACTAGG - Intergenic
972200137 4:36704093-36704115 TAAGTATCAGAGTTAGGATTGGG - Intergenic
973014913 4:45126098-45126120 TATGTAGCAGAGTTGGTGCAAGG + Intergenic
975276131 4:72504047-72504069 TAAATGGCAGAGTGGCAACTTGG - Intronic
975447742 4:74485948-74485970 TATGTACCAGAGTTTTAACTAGG - Intergenic
976138618 4:81965888-81965910 TAAGTGGCAGAGTTAGGCCTGGG - Intronic
977127599 4:93189105-93189127 TGTGGAGCAGATTTGGAACTGGG - Intronic
977255301 4:94733513-94733535 TAAGTGGCAGAGTTGGGGATTGG + Intergenic
977857467 4:101911130-101911152 TAAGTGGCAGAGCTGGGACTTGG + Intronic
980389823 4:132128743-132128765 TAAGAAGCTGATTTGGATCTTGG + Intergenic
981094422 4:140763553-140763575 TTAATAGCAAAGTTGGAAATTGG + Intergenic
981171125 4:141624470-141624492 TAAGTTGCTGAGTTGGGACTTGG - Intergenic
982156245 4:152524239-152524261 AAAGCAGCAGAGCTGGAACCTGG + Intronic
982417609 4:155155534-155155556 ATAACAGCAGAGTTGGAACTAGG - Intergenic
982808446 4:159795767-159795789 TAAGCAGCTGAGCTGTAACTTGG - Intergenic
983752237 4:171289331-171289353 TAAATAGCAGTGATGGAAGTGGG - Intergenic
983833236 4:172357986-172358008 TAAGAAGCAGAGTTTCAACTTGG - Intronic
984969497 4:185175007-185175029 TAAGTAGCAGATTAGCAATTTGG + Intronic
985347893 4:189026238-189026260 AAAGTAGCAGATCTGGAAGTGGG - Intergenic
985646371 5:1086571-1086593 TTAGGAGCAGGGCTGGAACTCGG - Intronic
991057445 5:62335218-62335240 TCAGTAGCAGGGTTGGAGTTGGG + Intronic
991411020 5:66345905-66345927 TAAGTGGCAGAGCTGGGATTTGG - Intergenic
991442691 5:66667632-66667654 TAAGTGGTGGAGTAGGAACTCGG - Intronic
995909012 5:117163361-117163383 TAACTATCACAGTTGGAAATAGG - Intergenic
997040816 5:130251326-130251348 TAATTAGCAGAGTTGACATTGGG + Intergenic
997248466 5:132370705-132370727 TAAGTAGCAGAGCCAGGACTTGG + Intronic
997412130 5:133698408-133698430 TAAGTGGCAGAGTTGGGATTTGG - Intergenic
997664785 5:135621158-135621180 TAAGTAGTAAAGCTGGCACTTGG - Intergenic
998256303 5:140591433-140591455 TAAGTTGAAGAGTTGTAAGTGGG + Intronic
999702491 5:154240808-154240830 TATGGAGCAGAGTTAGACCTGGG + Intronic
999906049 5:156142406-156142428 AACGTAGCAGCTTTGGAACTAGG + Intronic
1001300446 5:170529786-170529808 TAAATGGCAGAGTTGGAGTTTGG + Intronic
1004569590 6:16832439-16832461 CAAGGAGCAGGGTTGGAAGTGGG + Intergenic
1006213512 6:32417969-32417991 TCATTAGCAGAGTTGGATTTAGG + Intergenic
1008054691 6:46934309-46934331 TATCTAGCAGAGTTGACACTTGG + Intronic
1008143803 6:47864612-47864634 AATGTAAAAGAGTTGGAACTTGG - Intergenic
1008160852 6:48073716-48073738 TGAGTTGCAGAGTTGCAAATGGG + Intergenic
1009026402 6:58005616-58005638 TAAGTAGAAGAGTTAGGACTAGG + Intergenic
1009201952 6:60757089-60757111 TAAGTAGAAGAGTTAAGACTAGG + Intergenic
1009459546 6:63895442-63895464 TAGTTAGCAGAGTTGGAATCAGG + Intronic
1009926218 6:70124350-70124372 TAAGTAGCTAAGTAGCAACTAGG - Intronic
1011344490 6:86354000-86354022 TAAGTAGCAGAGCCAGGACTAGG + Intergenic
1013212437 6:107999131-107999153 GAAGGAGCAGAGTTGAAATTGGG - Intergenic
1016403141 6:143701997-143702019 TAAGTAGCAGAGTTGGAACTAGG + Intronic
1020601879 7:10285795-10285817 TTAGTAGCAGAGTTAGAGCTTGG + Intergenic
1021980157 7:26046346-26046368 TAAGTGGCAGAACTGGAATTTGG - Intergenic
1022159389 7:27693600-27693622 TAAGCAGCAGAGGTGGAAGAGGG - Intergenic
1022168863 7:27802676-27802698 TAAAAGGCAGATTTGGAACTTGG + Intronic
1022962734 7:35445072-35445094 CAAGTAGCAGAGTAGGGATTTGG - Intergenic
1022962884 7:35446653-35446675 CAAGTAGCAGAGTAGGGATTTGG - Intergenic
1023981825 7:45074876-45074898 TGAGCAGCAGAGTTGGATGTTGG + Intronic
1027529870 7:79316914-79316936 TTAGTAGCAGAGCTGGATCCAGG + Intronic
1027851493 7:83458260-83458282 TCATTAGCAGAACTGGAACTTGG - Intronic
1028462643 7:91113218-91113240 TGAGGAGCAGAGTTGGCAATTGG + Intronic
1030263855 7:107595513-107595535 TAAATAGCAGAATTTGAACTGGG + Intronic
1030702026 7:112650888-112650910 TATGCAGCATAGTTGGATCTTGG - Intergenic
1031324144 7:120371001-120371023 TAAGAAGCAGAGCTGCAACTAGG - Intronic
1031917714 7:127578769-127578791 TAAGTAGCAGAATTAGAAATCGG - Intergenic
1032129094 7:129214358-129214380 TCAGTAGAAGACTGGGAACTGGG + Intergenic
1034344464 7:150378141-150378163 TCAGTAGCACAGCAGGAACTGGG - Intronic
1035878268 8:3215409-3215431 TATGTACCAGACATGGAACTAGG + Intronic
1036788389 8:11702659-11702681 TAAGTAGCAGGCTAGGAATTGGG + Intronic
1037208351 8:16353787-16353809 AAAGTAGCAGAGATGAAATTAGG + Intronic
1037495783 8:19439479-19439501 TATGTTGCAGAGTAGGAATTAGG - Intronic
1037784951 8:21897121-21897143 TAAGTGGCTGAGCTGGGACTTGG - Intergenic
1039080992 8:33733796-33733818 TGAGTAGCAGAGCTGGGAGTTGG + Intergenic
1039118420 8:34118098-34118120 TAAGCAGAAGAGATGAAACTTGG - Intergenic
1039949878 8:42161810-42161832 TAAGTTTCAGTGTTGGAACTTGG + Intronic
1040498831 8:47990070-47990092 TAACTACAGGAGTTGGAACTGGG - Intergenic
1041934968 8:63323935-63323957 TCAGAAACAGAGTTGGAAGTGGG - Intergenic
1042947170 8:74166749-74166771 TAAGTGGCAGAATTGGGATTTGG + Intergenic
1043834166 8:85027600-85027622 TAAAATGCAGAGCTGGAACTAGG - Intergenic
1044402292 8:91786787-91786809 TAAGTAGCACTGCTGAAACTAGG - Intergenic
1044825630 8:96194180-96194202 GAAGAAGCAGAGTAGGAAGTTGG + Intergenic
1045118776 8:99013097-99013119 TAACTAGCAGGGTCGGAGCTGGG + Intergenic
1045160851 8:99542387-99542409 TCAGTGGAAGAGTTGGAAATAGG + Intronic
1045231955 8:100314419-100314441 TAAGTGGCAGAGCTGGGATTTGG + Intronic
1045748812 8:105457201-105457223 TCAGTAGCACATTTGGACCTTGG + Intronic
1046550724 8:115712582-115712604 TAAGAAGCAGAGTACGGACTGGG + Intronic
1046713260 8:117537931-117537953 TTAGAGGCAAAGTTGGAACTGGG + Intronic
1046776755 8:118172519-118172541 TAATTAGCTGAGTTGAACCTTGG + Intergenic
1047598759 8:126405733-126405755 TAAGTAGCAGGGCTGGAAATTGG - Intergenic
1047666992 8:127102405-127102427 GAATTAGCAAAGGTGGAACTGGG + Intergenic
1048002322 8:130388912-130388934 TCAGTGGCAGAAGTGGAACTTGG - Intronic
1051506642 9:17834433-17834455 TAAGAAGCAGAGTTTGAGGTGGG + Intergenic
1051729748 9:20128116-20128138 TAAGCAGCTGACTTGGACCTGGG - Intergenic
1052887034 9:33659575-33659597 AAAGAAGCAGAGTTGGAAGGAGG + Intergenic
1057897584 9:98922158-98922180 TAAGAAACAAAGCTGGAACTAGG + Intergenic
1057971452 9:99562151-99562173 TAAATAGAAGAGTTGGAATTGGG + Intergenic
1058387714 9:104458568-104458590 TAAGTGACAGAGTTGGAATTTGG - Intergenic
1060082651 9:120665496-120665518 TAAGGAGTAGAATTGGAGCTGGG - Intronic
1060105864 9:120873101-120873123 TAAGTGGCAAAGCTGGAACTTGG + Intronic
1060940353 9:127539853-127539875 TAGGTGGCAGAGCTGGGACTTGG - Intronic
1187962594 X:24580980-24581002 TAAGAAGTAGATTGGGAACTTGG - Intronic
1189266135 X:39717633-39717655 TAAGTGGCAGAGTTGGGATTTGG - Intergenic
1190727586 X:53199923-53199945 TAAGTGGCAGAGTGGGATTTGGG - Intronic
1192207151 X:69104010-69104032 TGAGTAGCAAAGTTGGAACTTGG + Intergenic
1193699478 X:84744033-84744055 TAACTACAGGAGTTGGAACTGGG + Intergenic
1195296847 X:103487007-103487029 TAAGTGGCAGGGTTGGAATGAGG + Intergenic
1196282771 X:113842608-113842630 TAAGTGGCAGAGCTGGGATTTGG - Intergenic
1197808962 X:130424257-130424279 AAAGTAGCTAAGTTGGCACTAGG + Intergenic
1198159639 X:133994796-133994818 TAAGTAATAGAGTTGGAATTTGG - Intergenic
1199426616 X:147709247-147709269 TAAGGGGCAGACTTAGAACTTGG - Intergenic
1199562142 X:149174177-149174199 TGAGAAGCAGCTTTGGAACTGGG - Intergenic
1200385611 X:155887576-155887598 TAAGTAGAAGAGTTGAAAGGAGG + Intronic