ID: 1016405226

View in Genome Browser
Species Human (GRCh38)
Location 6:143722964-143722986
Sequence GGAATATTATTCCACCATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 0, 2: 7, 3: 49, 4: 297}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016405226_1016405228 24 Left 1016405226 6:143722964-143722986 CCATTATGGTGGAATAATATTCC 0: 1
1: 0
2: 7
3: 49
4: 297
Right 1016405228 6:143723011-143723033 TTTACCCATTCATCTGTTGATGG 0: 51
1: 1169
2: 2946
3: 5147
4: 8352

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016405226 Original CRISPR GGAATATTATTCCACCATAA TGG (reversed) Intronic
900938604 1:5782911-5782933 GGAATATTACTCAGCCATCACGG + Intergenic
901526984 1:9829720-9829742 GGAAAAATATTCCTCAATAAGGG - Intergenic
903693077 1:25187938-25187960 TGAATAGCATTCCAGCATAAGGG - Intergenic
903941227 1:26932923-26932945 GGAATATTATTCAGCCTTAAAGG - Intronic
909525388 1:76616356-76616378 GGAATAGCATTCTACCTTAATGG + Intronic
910278431 1:85472313-85472335 GAAATATGATTGCACCAAAAAGG - Intronic
913014142 1:114716049-114716071 TGAATATGATCCCACCATAGAGG - Exonic
913428297 1:118759589-118759611 AGAATATTATATTACCATAATGG + Intergenic
916286999 1:163118603-163118625 GTAATATTATTTAACCTTAAAGG + Intronic
916913144 1:169373854-169373876 GAAATTTTATTTGACCATAATGG + Intronic
918057605 1:181035608-181035630 GGAATATTATTCCATATTATTGG - Intronic
918493258 1:185105969-185105991 GTAAAATTATTCCACAAAAACGG + Intergenic
918925863 1:190785110-190785132 GGAAAAATATTCCATCATCATGG + Intergenic
919046290 1:192456732-192456754 GGACTCTTATTGCACTATAATGG + Intergenic
921433946 1:215094838-215094860 GGAATATTATTTAAAAATAATGG + Intronic
921609350 1:217192593-217192615 GGAATTTTATTCTACCAGAGTGG - Intergenic
921709542 1:218359941-218359963 GAAAAATTATTCCCTCATAAGGG - Intronic
924744764 1:246821730-246821752 TAAAAATTATTCCACCAAAAGGG + Intergenic
1063488703 10:6443708-6443730 GGAATATTATTCAGCCTTCAAGG + Intronic
1063915285 10:10875922-10875944 GGAATATAAATGCACCATTAAGG - Intergenic
1064704995 10:18062359-18062381 GGAATATTATTCACAAATAAAGG - Intergenic
1065461479 10:25970240-25970262 AGAATATTATCTGACCATAATGG + Intronic
1065464377 10:26003231-26003253 GGAATATTATCTCATAATAATGG - Intronic
1066215633 10:33284192-33284214 AGATTATTATTCCAGCAAAAAGG + Intronic
1066228483 10:33408089-33408111 GGAAAATTATTGCACCAGGAAGG + Intergenic
1067950827 10:50737384-50737406 GGAATAATAATCCACTATGAAGG + Intergenic
1068272238 10:54743411-54743433 GGAATAATAATCCACAATGAAGG - Intronic
1068493400 10:57753510-57753532 GGAGTATTATTCAGCCATAAAGG + Intergenic
1068558862 10:58489873-58489895 GGAATATTATAATACTATAATGG - Intergenic
1068856876 10:61806649-61806671 GGGATATTATTCCACAATGCAGG + Intergenic
1069269579 10:66508723-66508745 GGAATACTAGTCAGCCATAAAGG - Intronic
1069318066 10:67132723-67132745 GGAATATTATTCAGCCATAAAGG + Intronic
1069397154 10:68001902-68001924 TGAATACTATTCCACTATAGAGG + Intronic
1070099848 10:73374679-73374701 GGAATATTATTCAGCCTTAAAGG + Intergenic
1072332841 10:94370385-94370407 GGAATAGTTTTCCAACAAAAGGG + Intergenic
1073272277 10:102275452-102275474 GGAATACTATTCCTACACAAGGG - Intronic
1073664214 10:105511463-105511485 AGACTATTATCCCACCATCATGG - Intergenic
1074057094 10:109932432-109932454 GGAATATTATTCTGCAAAAAAGG - Intergenic
1074261526 10:111858233-111858255 GGAATACTATGCAGCCATAAAGG - Intergenic
1075134466 10:119771295-119771317 GGAATATTATTCAGCTATAAAGG - Intronic
1075513721 10:123093176-123093198 CAAATAATATTCCACCATAATGG - Intergenic
1075958042 10:126541972-126541994 GGAACATTATTCCAACAAAAAGG + Intronic
1077598012 11:3551146-3551168 GGAATATTATTTGATCAAAAAGG - Intergenic
1078198653 11:9159187-9159209 GGAATATTATTGAGCAATAAAGG - Intronic
1078442102 11:11376819-11376841 GGAACATTATTCTACCATGCAGG - Intronic
1079226241 11:18607841-18607863 GGAAATTTATTCTAACATAATGG + Exonic
1079830469 11:25260610-25260632 AGAATATTATTCAGCCATAAAGG - Intergenic
1080332650 11:31157492-31157514 GGAATATTATTCAGGCCTAAGGG + Intronic
1080448674 11:32360630-32360652 AGAATATTATTCTGCCAAAAAGG - Intergenic
1080921956 11:36718060-36718082 TGCATATTAATCCTCCATAAAGG - Intergenic
1081315726 11:41626762-41626784 TTATAATTATTCCACCATAAGGG + Intergenic
1082923131 11:58517507-58517529 AGAATATTATTTCAACATAGTGG - Intergenic
1085599180 11:77839623-77839645 GGTATACTATGCAACCATAAAGG + Intronic
1086130014 11:83391481-83391503 GGAATGTTATTCTGCCACAAAGG - Intergenic
1086759254 11:90606762-90606784 GGAATACTATTCATCCATAAAGG - Intergenic
1087955479 11:104281592-104281614 GGAATACTATTCAGCAATAAAGG - Intergenic
1088150791 11:106742527-106742549 GGAATACTATGCAGCCATAAAGG - Intronic
1089738334 11:120564682-120564704 GGAATACTAATGCACCCTAAAGG + Intronic
1090682100 11:129071867-129071889 GGAATACTATTCAGCCTTAAAGG + Intronic
1092424163 12:8360475-8360497 CGAATAATATTCCACCATGTGGG + Intergenic
1093044149 12:14422736-14422758 AGAATATCATTCAACCACAAAGG - Intronic
1094306912 12:29030419-29030441 GGAATATGTTTCCAAAATAAAGG + Intergenic
1095133862 12:38574041-38574063 AGAATATTATACCACTGTAATGG + Intergenic
1095885021 12:47179472-47179494 GAAATATTATTTCGCCAGAATGG - Intronic
1097532756 12:60825949-60825971 GGAAAATAAATCCACCAAAAAGG - Intergenic
1097608454 12:61785297-61785319 AGAATACTATTCAGCCATAAAGG - Intronic
1097860088 12:64510116-64510138 GAAATATTACTCTATCATAATGG + Intergenic
1098730016 12:74024162-74024184 GGAATATTATTAGACAATATTGG - Intergenic
1099256483 12:80320538-80320560 GCAACATTTTTCCACCATCAGGG + Exonic
1099702552 12:86105812-86105834 GGAATATTCTATCAACATAAGGG + Intronic
1099718717 12:86333258-86333280 GGAATTTTTTTCCCCAATAATGG - Intronic
1101120069 12:101570204-101570226 GGGATTTTAGTCCATCATAAAGG - Intronic
1101281513 12:103262317-103262339 TGCATATAATTCCACCATAGAGG - Intronic
1101735416 12:107459609-107459631 GTAATATTCTTCCCCCAGAAGGG - Intronic
1102246049 12:111356646-111356668 GGAATATTTTTCAGCCTTAAGGG - Intergenic
1103145652 12:118593396-118593418 AGAATATTATTTGACCATAAAGG + Intergenic
1104702697 12:130919095-130919117 GGAATATGATTTCAACATGAGGG - Intergenic
1104702720 12:130919280-130919302 GGAATATGATTTCAGCATAAGGG - Intergenic
1104702748 12:130919529-130919551 GGAATATGATTTCAGCATGAGGG - Intergenic
1105228309 13:18459745-18459767 GGAATAGTATTTCATGATAATGG - Intergenic
1105810074 13:23987389-23987411 AGAATATAACTCCACCATCATGG - Intronic
1105972440 13:25442074-25442096 GAAACATTATTCAACCTTAAAGG - Intronic
1106306986 13:28521353-28521375 GGATTATTTTTCCACAAGAAAGG - Intergenic
1106520680 13:30495012-30495034 GGAATATGATTCCATCTTAAAGG - Intronic
1106668678 13:31881139-31881161 GGAATATTATTTAGCCTTAAAGG + Intergenic
1108086542 13:46799068-46799090 GGAAGATAATTACACCATGATGG - Intergenic
1108522249 13:51257025-51257047 GGAATATTATTCAGCCTTAAAGG - Intronic
1108680296 13:52774280-52774302 GGAATAGTATTCAGCCTTAAGGG - Intergenic
1110345366 13:74441347-74441369 AGAATATGATTCCACCCTAAAGG - Intergenic
1110472161 13:75872453-75872475 GGAATATTCTTCCCCTAGAAAGG - Intronic
1110562118 13:76920455-76920477 TGCATAGTATTCCACCATATAGG - Intergenic
1110823889 13:79949461-79949483 GAAATATTATTCCACATAAATGG - Intergenic
1110939228 13:81328546-81328568 GGAATACTATGCTGCCATAAAGG - Intergenic
1111535079 13:89593014-89593036 TGAATAGTATTCCACTTTAAAGG + Intergenic
1111603188 13:90500773-90500795 GGAAAGTTATTCCACTTTAAAGG + Intergenic
1111736505 13:92146846-92146868 GGAATACTATTCAGCCATAAAGG - Intronic
1112679815 13:101750839-101750861 GGAATATTATTCAGTGATAAAGG + Intronic
1112988807 13:105485764-105485786 GGAATATCACTCCATCATCACGG - Intronic
1114068584 14:19088897-19088919 GGAATATTATTCCTTTTTAAAGG + Intergenic
1114093680 14:19311117-19311139 GGAATATTATTCCTTTTTAAAGG - Intergenic
1114507513 14:23229199-23229221 AAAATATTATTCAGCCATAAAGG - Intronic
1115040557 14:28920165-28920187 ACAATATTATTTCATCATAAGGG + Intergenic
1115177763 14:30584224-30584246 TGAATAATATTCCATCATATGGG + Intronic
1115707620 14:36014755-36014777 GGAAATGTATTCCACCATGACGG + Intergenic
1116743726 14:48791935-48791957 GGAATTTGATTCCACCTTATAGG + Intergenic
1119024477 14:71141744-71141766 GGAATACTATTCAACCTCAAAGG - Intergenic
1119279687 14:73395009-73395031 CGAATACTATTCAACCTTAAAGG - Intronic
1119518203 14:75265099-75265121 GGTATATTATTCCACTATTTTGG - Intronic
1119581325 14:75784430-75784452 GGAATATTATTCAGCCATAAAGG - Intronic
1122166615 14:99829831-99829853 CGAATATTATTTGGCCATAAAGG - Intronic
1123823140 15:24052640-24052662 GTAAAATCATTTCACCATAAAGG - Intergenic
1124357039 15:29003385-29003407 TGAATGTTTTTCCACCATGAGGG + Intronic
1125138776 15:36377782-36377804 GGAATACTCTTCAGCCATAAAGG - Intergenic
1125337442 15:38640954-38640976 GGAATACTATTCAGTCATAAAGG - Intergenic
1126509420 15:49451726-49451748 GGAGTATTAATCCCCAATAAAGG - Intronic
1128195824 15:65755041-65755063 TGAATAATATTCCATCATATGGG - Intronic
1128429776 15:67580750-67580772 GCAGTATTATTCCACAGTAATGG + Exonic
1129744017 15:78005559-78005581 GGAATATTAGGCCACCAAATAGG + Intronic
1130920454 15:88339642-88339664 GGAATACTATTCAGCAATAAAGG - Intergenic
1131795266 15:96009911-96009933 GGTAAATTATTCCTCCAGAAGGG - Intergenic
1133440029 16:5813460-5813482 GGAATATGATTCAGCCATAAAGG + Intergenic
1135242792 16:20823998-20824020 GGAATGAGATTCCACCATAATGG - Intronic
1138725761 16:59137214-59137236 GGAATATTATTCCAGCTCAAAGG - Intergenic
1139070464 16:63375013-63375035 GGAAAAATATTCCACATTAATGG + Intergenic
1142902934 17:3024715-3024737 GGAATATTATTGCAGTAAAAAGG + Intronic
1146340580 17:32016232-32016254 GTAATATAATTCCTCCATTAAGG + Intronic
1146560915 17:33869532-33869554 TGAATAATATTCCACCATGTAGG - Intronic
1148059027 17:44822258-44822280 GGAATATTGTACAACCATTATGG + Intronic
1148175754 17:45562981-45563003 GTAATATAATTCCTCCATTAAGG - Intergenic
1148295620 17:46500021-46500043 GTAATATAATTCCTCCATTAAGG + Intergenic
1150032212 17:61751134-61751156 GGAAAATTATTCAACTATAAAGG + Intronic
1150406977 17:64909931-64909953 GTAATATAATTCCTCCATTAAGG - Intronic
1150754324 17:67897512-67897534 GGACTTTTATTCCACCATCTTGG - Intronic
1152062786 17:78091106-78091128 GGAATATTATTCCTAAATTAAGG - Intronic
1155228771 18:23753717-23753739 GCAGTATTATTACAGCATAAAGG + Exonic
1155453193 18:25984310-25984332 GGATTATGCTTCCACCATATGGG + Intergenic
1155491878 18:26407950-26407972 GCAGAATTATTGCACCATAAAGG + Intergenic
1156931790 18:42653761-42653783 TAAAAATTATTCTACCATAAAGG + Intergenic
1158961698 18:62593168-62593190 GGAATATTACTCAGCAATAAAGG + Intergenic
1159277319 18:66237233-66237255 GGACTATTACTCCACAATAAAGG + Intergenic
1159402236 18:67953661-67953683 GGAACATTATCCCTCCATAATGG + Intergenic
1162406482 19:10477568-10477590 TGCATATTATTCCATCATATAGG - Intergenic
1163780230 19:19242823-19242845 GGAATATTGTTCGGCCATAAAGG + Intronic
1164024776 19:21341825-21341847 GAAATATTATTCCAATATTATGG - Intergenic
1164444143 19:28302783-28302805 GGAATACTATTCAGCCATAAAGG + Intergenic
927515885 2:23671522-23671544 GAAATGGTATTCCTCCATAAGGG - Intronic
928757176 2:34541346-34541368 GGAATACTATGCAGCCATAAAGG - Intergenic
929195602 2:39181299-39181321 GGAATTTTATCCAACCATAGTGG - Intronic
929867538 2:45730927-45730949 GGAATATCATTGCTCCATAAAGG - Intronic
931629607 2:64287007-64287029 GGAATCTTATTCCACTATCTTGG + Intergenic
931729838 2:65143363-65143385 GAAATAATATTTCACCATATTGG - Intergenic
932841555 2:75087990-75088012 GGAAGTTCATTCCACCACAAAGG - Intronic
933502300 2:83129463-83129485 CAAATATTACTCCAGCATAATGG - Intergenic
933581674 2:84133986-84134008 GAAATATTATTCTACCATATTGG - Intergenic
933610419 2:84428565-84428587 GGAATATTGTTGCACTAGAAAGG + Intronic
934115128 2:88782189-88782211 GGCACATTATTACACCATATGGG + Intergenic
934628834 2:95892441-95892463 GGCAGATTATTACACCATATGGG - Intronic
934631525 2:95929847-95929869 GGCACATTATTACACCATATGGG - Intronic
934804273 2:97203466-97203488 GGCAGATTATTACACCATATGGG + Intronic
934804549 2:97207208-97207230 GGCAGATTATTGCACCATATGGG + Intronic
934804814 2:97210943-97210965 GGAAAATTATTACACCACATGGG + Intronic
934832790 2:97548312-97548334 GGCAGATTATTACACCATATGGG - Intronic
934832922 2:97550196-97550218 GGCAGATTATTACACCATATGGG - Intronic
934833685 2:97561440-97561462 GGCACATTATTACACCATATGGG - Intronic
935704795 2:105846971-105846993 GGAATGTTATTCAGCCTTAAGGG + Intronic
937174359 2:119913068-119913090 GGAAAATTATTCAGCAATAAAGG - Intronic
937191732 2:120108293-120108315 GGTACATTATTACACCATTAAGG - Intronic
937219224 2:120332100-120332122 AAAATAATATTCCAGCATAATGG - Intergenic
938253766 2:129836985-129837007 GGAGTACTATTCAGCCATAAGGG + Intergenic
938963805 2:136367715-136367737 AGTATATTTTTCAACCATAATGG + Intergenic
939440524 2:142243776-142243798 GGAATACTATTCAACAATAAAGG + Intergenic
941075772 2:161004972-161004994 GGAAGAATATTCCTCCAAAAAGG - Intergenic
941103690 2:161327020-161327042 GGAATATTATTAAACTTTAAAGG + Intronic
941203309 2:162541495-162541517 GGAATATTATGCAGCCAAAAAGG + Intronic
941724677 2:168848591-168848613 GGAATATTATTCAGCCAAAAAGG + Intronic
942809257 2:179977376-179977398 GGAATACTATTCAACCATAAAGG + Intronic
943887172 2:193234239-193234261 GGAATATGATTCCACCCAGAAGG + Intergenic
944976607 2:205060350-205060372 AGAAAATTTTTCCACCACAAAGG + Intronic
945396842 2:209328849-209328871 AGCATATTATTTGACCATAATGG + Intergenic
946951911 2:224885356-224885378 GGAATATTAATACTCAATAAGGG - Intronic
947983764 2:234431387-234431409 GGTATATTATTACACATTAAAGG - Intergenic
948780270 2:240317116-240317138 GGTATATTATTCAGCCATAAAGG + Intergenic
1169334646 20:4746171-4746193 GGAATGTTATTCAGGCATAAAGG + Intergenic
1169656967 20:7935205-7935227 TGAATAATATTCCATCATACAGG + Intronic
1170840072 20:19917794-19917816 GGAATAGCATTCCATCATATTGG + Intronic
1172042549 20:32056009-32056031 GGAATATTATTTGGCCACAAAGG - Intronic
1172043342 20:32061676-32061698 GGAATATTCTTCACCCAGAAAGG - Intronic
1172757684 20:37298589-37298611 GGAGTATTACTCAGCCATAAAGG - Intronic
1174213341 20:48897517-48897539 GGAATATGATTCAGACATAAAGG - Intergenic
1174946297 20:54989418-54989440 TGAATAATATGCCACCAAAATGG - Intergenic
1174953748 20:55072866-55072888 GGAACATTATTCAGCCAAAAAGG - Intergenic
1176772289 21:13087925-13087947 GGAATAGTATTTCATGATAATGG - Intergenic
1176887760 21:14276320-14276342 CAGAAATTATTCCACCATAAAGG + Intergenic
1179773764 21:43645701-43645723 GGAACATTACTCCACCCTAGAGG + Intronic
1180487055 22:15811458-15811480 GGAATATTATTCCTTTTTAAAGG + Intergenic
1181158634 22:20942409-20942431 GGAATATTATTCAGCCCTAAAGG - Intronic
1183312336 22:37117341-37117363 GGAATAAGAATCCACCAGAATGG + Intergenic
949169067 3:976997-977019 GGAATATTTTTGCACAATTAAGG - Intergenic
951026482 3:17836088-17836110 GGCATATTATTCCCCCAAAGGGG + Intronic
951688502 3:25371232-25371254 GTATTATTATTCCAAAATAATGG - Intronic
952646678 3:35668169-35668191 GGAATACTCTTCCCCCAAAATGG - Intronic
953479848 3:43241697-43241719 GGAATATTATTTAGCCATAGAGG + Intergenic
953724402 3:45385082-45385104 GGAATATTATTCAGCCCTTAAGG - Intergenic
954252539 3:49379185-49379207 GGAATATTATTCAGCGATAAAGG + Intronic
955974684 3:64468586-64468608 GGAAGAAAATTACACCATAAAGG - Intergenic
957434343 3:80154313-80154335 GAAATATTCTTCAAACATAAAGG - Intergenic
957976693 3:87454784-87454806 GGAAAAATATTCCATCATTATGG - Intergenic
959747104 3:109788955-109788977 TGACTATTAGTCCACCATAAAGG + Intergenic
961029174 3:123586885-123586907 GGAAGTTTATTCAAGCATAAAGG + Intergenic
962198685 3:133383993-133384015 CAAATATTCTTCCACCTTAATGG - Intronic
963822459 3:149912749-149912771 GACATATTATTTCTCCATAACGG + Intronic
964891203 3:161537661-161537683 GGAATACTATTCAGCCATAAAGG - Intergenic
967468266 3:189832760-189832782 GGAATATTAATCCTCCATCCTGG - Intronic
969133197 4:5007355-5007377 GGAATACTATTCAGCCAAAAAGG + Intergenic
970032150 4:11688234-11688256 GGAATATTATTCAGAGATAAAGG + Intergenic
971084643 4:23258365-23258387 GGAATACTATGCAGCCATAAAGG + Intergenic
971362181 4:25948340-25948362 AGAATATTATTCAGCCAAAAAGG - Intergenic
971669945 4:29543333-29543355 GGGTTATTTCTCCACCATAATGG - Intergenic
972198765 4:36686849-36686871 TAAAAATTTTTCCACCATAACGG + Intergenic
973192441 4:47401031-47401053 GGAGTACTACTCAACCATAATGG - Intronic
973289062 4:48452169-48452191 GGAATACTATGCAGCCATAAAGG + Intergenic
974198314 4:58605506-58605528 GGAAAATTTTTCTACCATAAAGG - Intergenic
975787612 4:77908641-77908663 GTAATATTGTTGCACCATTATGG - Intronic
976301073 4:83516092-83516114 GGACTATTATTCCACAATGGTGG - Intronic
976492174 4:85683934-85683956 GGAATATCATTCAGCCTTAAAGG - Intronic
976746110 4:88404499-88404521 GAAATATTATTCAGCCTTAAAGG - Intronic
977728178 4:100321658-100321680 TGAATACTATTCCACAATGAAGG + Intergenic
979915671 4:126430596-126430618 GGAATATTATTCAACAACAAAGG + Intergenic
981290291 4:143067250-143067272 GGAATATTATTCCATCCTCATGG - Intergenic
981354087 4:143766763-143766785 GGAATATTATTCAGCAAAAAAGG - Intergenic
983358222 4:166692553-166692575 GGAATATTATGCCATAATTATGG - Intergenic
983693016 4:170495679-170495701 GGAATACTATGCATCCATAAAGG + Intergenic
984671651 4:182496206-182496228 GTATTACTATTCCACCTTAATGG + Intronic
987240336 5:15991549-15991571 AGAATAATATGACACCATAATGG - Intergenic
987656364 5:20812807-20812829 TTAATATTATTCCACAATACTGG + Intergenic
987977603 5:25034467-25034489 TGAATATTATTGTACGATAAAGG - Intergenic
988184559 5:27844032-27844054 AGAAAATTATTCCTCCTTAAAGG - Intergenic
988258394 5:28850299-28850321 GGACTATTATTCCACAATGTAGG + Intergenic
988293714 5:29326585-29326607 GGAACATTGTTCAACCATAAAGG + Intergenic
988635053 5:32974168-32974190 GGAATAATATTCCATTGTAAGGG + Intergenic
988649752 5:33135691-33135713 AAAATATTATTCCACCTAAATGG - Intergenic
988673942 5:33411774-33411796 GTAATATAATCCCACCCTAATGG - Intergenic
988767193 5:34391139-34391161 TTAATATTATTCCACAATACTGG - Intergenic
991313603 5:65274237-65274259 TCAATATTATTCCTACATAAAGG + Intronic
991313934 5:65278164-65278186 GGAATACTACTCAGCCATAAAGG - Intronic
991963616 5:72069727-72069749 AGAATATTATTCAGCCATAAAGG + Intergenic
992202706 5:74399992-74400014 GGAATATTTTTTCACCATGGGGG - Intergenic
992464077 5:76986730-76986752 GCAATATTCTTCCTCCATACAGG - Intergenic
993286687 5:86008229-86008251 GGAAAAATATTCCACATTAATGG - Intergenic
993601240 5:89927713-89927735 GGAATACTACTCAGCCATAAAGG + Intergenic
993974422 5:94459160-94459182 GGAATATTATTCAGTAATAAAGG - Intronic
995275754 5:110276093-110276115 GGAATATTATTAAGCCCTAAAGG + Intergenic
995637595 5:114212193-114212215 GAAATATTATTTGGCCATAAAGG + Intergenic
995959107 5:117817679-117817701 GGAATACTATGCAGCCATAAAGG - Intergenic
998631422 5:143903077-143903099 GGAAAACTATACCTCCATAAGGG + Intergenic
999123178 5:149225891-149225913 GGAATACTACTCAGCCATAAAGG - Intronic
999235655 5:150091417-150091439 TGAATATTATTCAGCTATAAAGG + Intronic
999539154 5:152553019-152553041 GGAATATTATTCAGTCTTAAAGG + Intergenic
1006245808 6:32734176-32734198 GGAATATTATGCAGCCATAAAGG + Intergenic
1009930519 6:70172341-70172363 GGAACATTATTCCTCCAGACTGG - Intronic
1010416661 6:75619413-75619435 GGAATGTTATTCAGCCTTAAAGG - Intronic
1010516584 6:76780229-76780251 GGAATATTATTCAGCCAAAAAGG + Intergenic
1011596339 6:89020237-89020259 GGAACTTTATTCCATCATTAGGG + Intergenic
1011596345 6:89020289-89020311 GGAACTTTATTCCATCATTAGGG + Intergenic
1012143619 6:95653858-95653880 GGAATACTAATCAACTATAAAGG + Intergenic
1013497639 6:110714251-110714273 GGAATATTATTCAGCCATACTGG - Intronic
1014224678 6:118834197-118834219 GGAATACTATGCAGCCATAAAGG - Intronic
1015520684 6:134128093-134128115 GGAATATTATTTTGCCATAAAGG + Intergenic
1015651964 6:135472372-135472394 GGAATACTACTCCACAAAAAAGG - Intronic
1015959660 6:138633583-138633605 GAAATATTCTTCAAACATAAAGG + Intronic
1016153477 6:140773710-140773732 GGAAGGTTTTTCCCCCATAAAGG + Intergenic
1016405226 6:143722964-143722986 GGAATATTATTCCACCATAATGG - Intronic
1016470888 6:144373320-144373342 GGAGTATTATTCAGCCATACAGG + Intronic
1016588214 6:145713881-145713903 GGAATATTACTCAGCAATAAGGG + Intronic
1016792753 6:148083054-148083076 GGAATTTTGTTCCATCAGAAAGG - Intergenic
1016835068 6:148468915-148468937 TGCATAATATTCCACCATATTGG - Intronic
1020571024 7:9861608-9861630 GGACTATTATTCAGCTATAAAGG + Intergenic
1021232244 7:18099673-18099695 GGAATAGTATTTCAGAATAACGG + Intronic
1021271150 7:18588006-18588028 GGAATATTATTTCATTACAATGG + Intronic
1021357123 7:19664109-19664131 AGAATATTATTCAGCCTTAAAGG + Intergenic
1021384344 7:20009514-20009536 GGAATATTTTTGCACCATAAGGG + Intergenic
1022006314 7:26268802-26268824 GGAATATTATTCAACAATACAGG - Intergenic
1022740563 7:33116399-33116421 GGAGTACTATTCAACCATAAAGG - Intergenic
1024434292 7:49331565-49331587 GGAATACTATGCCACCATAGTGG + Intergenic
1024543097 7:50495148-50495170 GGAATATCATTGCAACATACTGG - Intronic
1025039958 7:55633006-55633028 AGAATAGTGATCCACCATAAAGG - Intergenic
1026512691 7:71040070-71040092 GGAATATTATTCAGCCTTAAAGG - Intergenic
1028081322 7:86580572-86580594 AGAATATTATTTCAATATAAAGG + Intergenic
1028181305 7:87728653-87728675 TGGATATTATCCCACCATATGGG - Intronic
1028832158 7:95340062-95340084 AGATTATTATTCCACCAGAGAGG - Intergenic
1029361224 7:100089718-100089740 GGAATATTATTACACCAAGGAGG + Exonic
1029945248 7:104526141-104526163 GGAATTTTCATGCACCATAAGGG - Intronic
1030146710 7:106364296-106364318 GGAATACTATGCAGCCATAAGGG + Intergenic
1031259895 7:119505707-119505729 TGGATATTATCCCACCATATGGG - Intergenic
1033219352 7:139517991-139518013 GGAATTTTCTACCCCCATAATGG + Intergenic
1034247341 7:149656960-149656982 GGAATATTATTTGGCCACAAGGG + Intergenic
1034614486 7:152403759-152403781 CGAATACTATTCAGCCATAAAGG + Intronic
1038469419 8:27800749-27800771 GGGATGTTATTCAGCCATAAAGG + Intronic
1041509690 8:58642295-58642317 TGAAAATTGTTCCACCAAAAAGG - Intronic
1041634087 8:60122878-60122900 GGAAAATTATTCCACATGAAGGG - Intergenic
1042003203 8:64150046-64150068 AGGAAATTATTACACCATAAGGG + Intergenic
1042090141 8:65150347-65150369 GGAATAGTATGCCAACAAAAAGG + Intergenic
1043258599 8:78168079-78168101 GGAATGTTATTCCTCCTCAAAGG + Intergenic
1043788441 8:84432186-84432208 GGAATATTATTCAGCCTTTAAGG + Intronic
1046018872 8:108639612-108639634 GGAAAATTATCCCACCCAAAAGG - Intronic
1046033438 8:108811495-108811517 GGAATATTGTTCCAACATCTTGG - Intergenic
1047626619 8:126663465-126663487 GAAATATTATTCAACACTAAGGG + Intergenic
1047639959 8:126808037-126808059 GGTATATTATTCAGCCACAAAGG - Intergenic
1048030267 8:130625091-130625113 TGAATATAAGTCCAACATAAGGG + Intergenic
1048082051 8:131139113-131139135 TGAATATTTTTCCCCCAGAATGG - Intergenic
1048101991 8:131362352-131362374 GGAATACTATTCTGCCACAAAGG + Intergenic
1048302799 8:133263985-133264007 GGAATATTATTATTCAATAAAGG + Intronic
1049044042 8:140135438-140135460 GGAATATTATTCAGCCATAAAGG + Intronic
1049703851 8:144028858-144028880 GGAATATTATGCCATAAAAAGGG + Intronic
1050844613 9:10198997-10199019 GGTATCTTATGCCAACATAAGGG - Intronic
1051074439 9:13214223-13214245 GGAATATTATTCAGCAATAAAGG + Intronic
1051086446 9:13354815-13354837 AGAATATTATTGAACCAGAAAGG + Intergenic
1051596736 9:18831535-18831557 AAAATATTATTCCAGAATAAGGG - Intronic
1052128668 9:24812878-24812900 GGTATATTATTTGACAATAAAGG + Intergenic
1052210452 9:25896642-25896664 GGCATACTATTCCACCATATGGG - Intergenic
1053703074 9:40720287-40720309 GGAATAGTATTTCATGATAATGG + Intergenic
1054821581 9:69526737-69526759 AGAATATTGTTCTACCAAAAAGG + Intronic
1054856893 9:69910168-69910190 GGAATATTATTCATCCAAAAAGG - Intergenic
1055176935 9:73330960-73330982 GGTATATTTTTCAACCACAATGG - Intergenic
1056912230 9:90712394-90712416 GGAATATTACTCAGCAATAAAGG + Intergenic
1057332023 9:94124118-94124140 GGAATGTTATTCCACTTTAAAGG - Intergenic
1057540697 9:95966386-95966408 TTATTATTATTTCACCATAATGG + Intronic
1057753999 9:97816198-97816220 AGTATATTTTTCAACCATAATGG - Intergenic
1059321320 9:113472423-113472445 GGAATATTATTTGGCCACAAAGG + Intronic
1059547179 9:115188816-115188838 GCTGTATTATTCCACGATAAAGG - Intronic
1060884949 9:127144653-127144675 GGAATACCATTCAGCCATAAAGG + Intronic
1061321573 9:129834134-129834156 GGAATATTATGCAGCCATTAAGG + Intronic
1203582499 Un_KI270746v1:23910-23932 GGCACATTATTACACCATATGGG + Intergenic
1188518375 X:31011685-31011707 GGAATATTATTCAGCCATAAAGG + Intergenic
1188621330 X:32228342-32228364 TGAATATTTTTCCATCATGATGG - Intronic
1189999168 X:46668553-46668575 GGAATATTATTCAGCCTTAAAGG + Intronic
1191630949 X:63321651-63321673 GGAATAATATGCAGCCATAAAGG + Intergenic
1193164078 X:78262057-78262079 TGAATTTGATTCCATCATAATGG + Intergenic
1193545683 X:82825333-82825355 GGAATATTATTTATCCTTAAGGG - Intergenic
1193804303 X:85975443-85975465 TGAATAGTATTCCACAGTAATGG - Intronic
1193853546 X:86570391-86570413 GGAATACTATGCAGCCATAAAGG + Intronic
1194397050 X:93399380-93399402 GGAAAATAATTCCAACATATAGG - Intergenic
1195418140 X:104642345-104642367 GGTGTAATATTCCACCATATGGG + Intronic
1195499270 X:105575510-105575532 GGAATACTATGCAGCCATAAAGG - Intronic
1197996016 X:132374181-132374203 GAAATCTTATTCTATCATAACGG + Intronic
1198792981 X:140365557-140365579 TGAATATTATTCAGCCTTAAAGG + Intergenic
1199179039 X:144831080-144831102 GGAATATTTTGGCACCACAATGG + Intergenic
1199200658 X:145085309-145085331 GGAATATAATTTTTCCATAAGGG + Intergenic
1199707212 X:150438697-150438719 GGAATATTATTCAGCCATAAAGG - Intronic
1199889448 X:152061055-152061077 GAAATATTATTAAGCCATAAAGG + Intergenic
1201350956 Y:13040771-13040793 AGAATATTATTCGGCCTTAAAGG + Intergenic
1201761784 Y:17548016-17548038 GGAAAATTATTCCATGTTAATGG + Intergenic
1201839768 Y:18357974-18357996 GGAAAATTATTCCATGTTAATGG - Intergenic
1201989011 Y:20004022-20004044 GCAATACTATTCAGCCATAAAGG + Intergenic