ID: 1016405464

View in Genome Browser
Species Human (GRCh38)
Location 6:143724975-143724997
Sequence ATGAACAAGTTCACTTTCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 198}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016405464 Original CRISPR ATGAACAAGTTCACTTTCTA TGG Intronic
901560200 1:10063990-10064012 ACGAACAAGTTCAGTGTCTTAGG + Intronic
903129084 1:21266652-21266674 AGGAAGCAGTTCACTTTCTCAGG - Intronic
905781968 1:40719475-40719497 AGGATCAAGTTCACTTTCTGGGG - Intronic
907382134 1:54099851-54099873 ATAAGCAAGTTCAGTTGCTAGGG + Intronic
908201584 1:61801400-61801422 ATTAATAAGTTCATTTTTTAAGG + Intronic
909519884 1:76555509-76555531 ATGACCAGGTTCACTTTGTTTGG - Intronic
912099400 1:106186807-106186829 ATCAACAACTTAACTTGCTATGG + Intergenic
916028180 1:160853633-160853655 ATCTACAAATTCACTTGCTATGG - Intronic
918507686 1:185274764-185274786 ATGAACAATTTTAATTTCCAGGG - Intronic
918794629 1:188877089-188877111 ATGAATATGTATACTTTCTAGGG + Intergenic
920593540 1:207245929-207245951 ATTAATAATTTCACATTCTAAGG - Intergenic
920797859 1:209158119-209158141 ATGAATGAGTTCACTTTCACAGG + Intergenic
920939921 1:210472562-210472584 CTGAACCATTTCCCTTTCTAGGG - Intronic
921840891 1:219827298-219827320 ATGATCAAGTTCATATTCTTTGG + Intronic
922941104 1:229467124-229467146 ATTAGCAAGTTCACTTTTTGAGG - Intronic
923856485 1:237850550-237850572 AAGAACAAATTCCCTCTCTACGG + Intergenic
924812686 1:247416980-247417002 ATGAACAAGTTGGCTTTGTTTGG - Intronic
1066201019 10:33142682-33142704 TTGAACAAGCCCATTTTCTATGG - Intergenic
1068151851 10:53142243-53142265 ATGAAAAAGTTAATTTTCTCTGG - Intergenic
1068178337 10:53490640-53490662 ATCCACAGGTTCATTTTCTATGG - Intergenic
1068494329 10:57766521-57766543 ATGAAGAACTCCACTTTATAGGG - Intergenic
1071322123 10:84472677-84472699 ATGTAAAAGGTCACTTTATATGG + Intronic
1071334856 10:84592018-84592040 TTTAACAAATTCACTATCTATGG - Intergenic
1071968519 10:90877879-90877901 ATGAAACAGTTCACCTTCTCAGG - Intronic
1072279953 10:93856679-93856701 ATTCACAGTTTCACTTTCTATGG + Intergenic
1073832402 10:107400813-107400835 ATGAACAAGAACAATTTCTGGGG - Intergenic
1075325367 10:121527638-121527660 GTGAACAAGATCAATTTCTAGGG + Intronic
1075425986 10:122342035-122342057 ATGAATAAATTTACTTTCTCTGG - Intergenic
1076632980 10:131863097-131863119 ATGTGCAATTTCACTTTCTGTGG - Intergenic
1077953512 11:6988577-6988599 CTCAACAAGTTCACTTTTGAGGG - Intergenic
1080551171 11:33375442-33375464 ATGAGCCAGGTCACTTGCTAAGG + Intergenic
1080754651 11:35185109-35185131 ATGAACAAGATAAGTTTATATGG + Intronic
1086007632 11:82057411-82057433 ATCAACAGGTTCAATTTCTGTGG - Intergenic
1087146461 11:94817798-94817820 ATGAACACATTAGCTTTCTATGG - Intronic
1087468260 11:98537951-98537973 ATTAGCAAGTTCGCTTTCTTTGG - Intergenic
1088088507 11:106009727-106009749 TTGACCAAGTTCATTTTCCAAGG + Exonic
1093003326 12:14024718-14024740 ATGACCAAGTTCAGTATCAATGG - Intergenic
1094881885 12:34796027-34796049 ATGAAGAAGTCCCTTTTCTAAGG - Intergenic
1095357207 12:41289536-41289558 ATGAAGATGGTCAATTTCTAAGG + Intronic
1095908656 12:47403630-47403652 AGGAACAAGGTCAGTTTCTCAGG - Intergenic
1096937389 12:55297357-55297379 ATGAAAAAGTTCACCTTTTGTGG - Intergenic
1105794544 13:23837958-23837980 AAGAACACATTCAGTTTCTATGG + Intronic
1106919629 13:34549506-34549528 AGGCACAAGTTGACTTTCCATGG + Intergenic
1107007297 13:35628082-35628104 AGAAACAAATTCACTTTCTAGGG - Exonic
1108942990 13:55981320-55981342 ATGAACAAATGCACTATCAAAGG - Intergenic
1109362204 13:61308480-61308502 ATGGAGAAGTACACTTTCTAAGG - Intergenic
1109737590 13:66506954-66506976 ATGGACAAGTTCTCATTCTTAGG + Intronic
1110124363 13:71924191-71924213 AAGAAGGAGTTCACTTTCTCCGG + Intergenic
1110403316 13:75119701-75119723 ATTCACAATTTCACTTTCCATGG + Intergenic
1111854225 13:93616361-93616383 ATGAACAACTTCCCTTTGAATGG - Intronic
1112795059 13:103047817-103047839 ATCAACCAGTCCACTTTCTCTGG + Intronic
1113361588 13:109636297-109636319 ATAAACAAGTTTATATTCTAAGG - Intergenic
1114229563 14:20768303-20768325 AGGAACAAGTTCACATAATAAGG + Intergenic
1115657625 14:35459099-35459121 AGGCACAGGTTCACTTTCCAAGG - Intergenic
1116279130 14:42879543-42879565 CTGCACATGTTCACTTTCTATGG - Intergenic
1116998561 14:51349332-51349354 TTGAAAAAGTTCATTTTCCAGGG + Intergenic
1121147841 14:91601241-91601263 AGGAAAAAGATCACTTTCAATGG - Intronic
1121207271 14:92179893-92179915 AAGAACATGTACACTTTCTTTGG + Intergenic
1127324158 15:57878641-57878663 AGTAAAAAGTTCACTCTCTATGG + Intergenic
1129573563 15:76715896-76715918 AGGCACAGGTTCACTTTCCAAGG - Intronic
1129633416 15:77288378-77288400 AGGTACAAGATCACTTTCTCTGG + Intronic
1131321965 15:91402478-91402500 AGGAACAAGTTAACTCTCTGGGG - Intergenic
1133539513 16:6735698-6735720 ATAACCAAATTCAGTTTCTAGGG - Intronic
1133613475 16:7454492-7454514 ATGATCAAGTTGAGTTTATAAGG + Intronic
1136335608 16:29608487-29608509 ATAAATAAAATCACTTTCTATGG + Intergenic
1137029638 16:35509740-35509762 ATAAACAAGTTAATTTTCCATGG - Intergenic
1145748212 17:27336230-27336252 ATGAACAAGTTCTCCTTCGCTGG - Intergenic
1146781176 17:35674056-35674078 GTGAACAAATTCACTTCCTTAGG - Intronic
1147290587 17:39439051-39439073 AGGAACAAGTTTATTTTCTTGGG - Intronic
1147304080 17:39551257-39551279 ATGGACAGGTTCAGCTTCTATGG + Intronic
1153335896 18:3924551-3924573 ATGAACAAGTTCACCTCCAAGGG - Intronic
1153356376 18:4141353-4141375 ATAAACAAATTCATTTTCAAAGG - Intronic
1153762981 18:8349659-8349681 ATGGACAAGCTTAGTTTCTAAGG - Intronic
1154298851 18:13175252-13175274 ATGAACAGTGTCACTCTCTAAGG + Intergenic
1156181016 18:34604324-34604346 CTGAATAATTTCTCTTTCTATGG - Intronic
1156757587 18:40547273-40547295 ATGAATAAAATCTCTTTCTAGGG - Intergenic
1157169611 18:45390459-45390481 ATGAATAAATTCACCTACTAGGG - Intronic
1157244187 18:46039096-46039118 ATGAACAGGTTCTATTTGTAAGG - Intronic
1157852607 18:51070570-51070592 ATCCACAATTTCACTTTCCATGG + Intronic
1164922001 19:32095237-32095259 ATGAATAGGTTCAGTGTCTAGGG + Intergenic
925375847 2:3384764-3384786 ATGACCCAATTCACTTTATAAGG - Intronic
925858199 2:8150672-8150694 ACTAAAAATTTCACTTTCTAGGG - Intergenic
926882689 2:17565085-17565107 ATGAACATGATTACTGTCTATGG + Intronic
930930092 2:56871405-56871427 TTGAACAAGATCACATACTAAGG + Intergenic
931307310 2:61042782-61042804 TTAAACAAGTTTACTTTCTCTGG - Intronic
933231953 2:79818154-79818176 ATTAAGAAGTTCACTTTTTTTGG + Intronic
933897529 2:86825142-86825164 ACCAACAAGTTCACTTACCAAGG - Intronic
935951496 2:108333930-108333952 GTCAACAAGGTCACTTTCTTAGG - Intergenic
936451010 2:112634176-112634198 CTGAAGAAGTTAACGTTCTAAGG + Intergenic
936800861 2:116263602-116263624 TTTAACAAGTTTTCTTTCTAAGG - Intergenic
937417024 2:121723576-121723598 ATCAACAAGTTTATTTTCTCTGG + Intergenic
939346571 2:140973542-140973564 ATAAACAAGTTGGCTTTTTAGGG - Intronic
940245936 2:151616145-151616167 ATGAACAGCTTCACTTTTTATGG - Intronic
941237690 2:162995721-162995743 ATGCACAAGTAATCTTTCTATGG - Intergenic
942081031 2:172399707-172399729 ATGAACAAGGTCTCTTTACAGGG + Intergenic
943021944 2:182585418-182585440 ATGAATACGATCACTTTCTGTGG - Intergenic
944518558 2:200539253-200539275 ATGAAACAGATAACTTTCTAAGG - Intronic
1168774710 20:438209-438231 ATGTTCCAGTTCACCTTCTATGG + Exonic
1171537866 20:25913071-25913093 ATGAAGAGGTTAACTTTTTAGGG + Intergenic
1173676819 20:44843253-44843275 ATGAACAAGGTCACTAGCCAAGG - Intergenic
1174512898 20:51068436-51068458 ATGAATATTTTCATTTTCTATGG - Intergenic
1174649670 20:52113848-52113870 ATGTACAAGGTCACTTTAGAGGG + Intronic
1175396127 20:58663358-58663380 ATGGACAAGTTCTCCATCTATGG - Intronic
1175410051 20:58761858-58761880 AGGGACAAGTTCAATTTCAATGG - Intergenic
1178693070 21:34766062-34766084 ATGAACAAGCTACTTTTCTAAGG + Intergenic
1180620113 22:17155702-17155724 ATGTACACCTTCACTTTTTATGG - Intronic
1181159639 22:20951116-20951138 ATGAACAACGCCACTTTTTAAGG - Exonic
1181621685 22:24095559-24095581 ATGTAGAAACTCACTTTCTATGG + Intronic
951354200 3:21644146-21644168 ATAAACAAGTTATGTTTCTATGG + Intronic
951520224 3:23604481-23604503 ATTAACATATTCATTTTCTAGGG - Intergenic
951915942 3:27800892-27800914 ATGAGCAAGTTCAATCTCTTTGG + Intergenic
956731885 3:72203924-72203946 ATTCACAAGCTCACTTTCCAAGG - Intergenic
957517953 3:81280454-81280476 AGGAACAAGTTCACACTATAAGG + Intergenic
959880447 3:111439279-111439301 CTGTACAAGTTGACCTTCTAAGG - Intronic
960923841 3:122777472-122777494 ATGAACAAATACATTTTGTATGG + Intronic
962169976 3:133091209-133091231 ATGGAAAAGTTCAATTTCTCAGG - Intronic
962544117 3:136414700-136414722 ATCAACAGAGTCACTTTCTATGG + Intronic
962631502 3:137280755-137280777 ATGACCAAGGACACATTCTAAGG + Intergenic
963496833 3:146074906-146074928 AGGAACAAGTTTTCTTTCCATGG - Intronic
963721059 3:148862501-148862523 ATTAACATGTTAACTTGCTATGG - Intergenic
964405286 3:156342351-156342373 GTGAAGAAATTCACTTTCTTTGG - Intronic
964452342 3:156824329-156824351 ATGAAAATGTTCAGTATCTATGG + Intergenic
965136250 3:164773303-164773325 AGGAATAAGTTCATTTTCTAAGG - Intergenic
966333123 3:178837921-178837943 AGGAAAAACTTCACTTTCAATGG + Intronic
970233836 4:13938689-13938711 CTGAACAAGTTCACTCCCTCTGG - Intergenic
974218879 4:58939360-58939382 ATGACCAAATTGTCTTTCTAAGG - Intergenic
975631567 4:76409498-76409520 ATGAACAGGTTCACATTAAAAGG + Intronic
977379902 4:96259248-96259270 ATGAACAACTAGACTTTCTATGG + Intergenic
978190223 4:105902639-105902661 ATCAAAAACTTCACTTCCTAAGG - Intronic
980101849 4:128549616-128549638 ATCAACAACTTAACTTTCTCTGG - Intergenic
983946231 4:173588529-173588551 ATGATGAAGTTTACTTCCTAAGG + Intergenic
986278389 5:6302067-6302089 AGAAACAAGTTCAGTATCTAAGG + Intergenic
987106943 5:14648603-14648625 ATAAAGAAGTTTTCTTTCTAAGG - Intergenic
989827719 5:45879164-45879186 TTAAACAAGTTTATTTTCTATGG + Intergenic
990495481 5:56343547-56343569 ATGAAAAAGTTTAGTTTTTAAGG - Intergenic
990641922 5:57795349-57795371 AAGAACAAGGTCACTATCCATGG - Intergenic
991041823 5:62184034-62184056 ATGAAGAAGTGCTCTTTCTGAGG - Intergenic
993608288 5:90022093-90022115 AAGAACAATTTCACTTTCACTGG + Intergenic
996465927 5:123802792-123802814 AAGCACAAGCCCACTTTCTAGGG - Intergenic
996616744 5:125451113-125451135 ATGTACATGTTAACTTTCCATGG + Intergenic
997070745 5:130619412-130619434 ATGAATAAGTTCAGTCTCTCAGG + Intergenic
997299521 5:132792312-132792334 TTGGACAAGTTAAGTTTCTAAGG - Intronic
998291900 5:140924209-140924231 AAGAATAAGTTCAATTTTTATGG + Intronic
998422089 5:141996985-141997007 ATCCACAGTTTCACTTTCTATGG + Intronic
1001135368 5:169098204-169098226 AGGAAGAACTTCCCTTTCTATGG + Intronic
1004010661 6:11683066-11683088 TTGAACAAGTTTATTTTCTCTGG - Intergenic
1005036042 6:21555709-21555731 ATCAAGAAGTTCTATTTCTAGGG + Intergenic
1005281721 6:24281900-24281922 ATAAATAAATTAACTTTCTAAGG + Intronic
1005486544 6:26305737-26305759 ATGACAAAGTACACTTTCTAAGG + Intergenic
1005890303 6:30131909-30131931 ATGGATCAGTTCACTTTCTTGGG + Intergenic
1007329954 6:41098652-41098674 ATGAAAATGCTCGCTTTCTAGGG - Exonic
1007906880 6:45470881-45470903 ATGAATCAGTTTAATTTCTATGG - Intronic
1009026670 6:58008220-58008242 AAGCACAAGATCACTTTCAATGG - Intergenic
1009202213 6:60759693-60759715 AAGCACAAGATCACTTTCAATGG - Intergenic
1012076827 6:94698455-94698477 TTGATCAAATTCACTTTCGAAGG - Intergenic
1013755930 6:113461561-113461583 ATGAGATAGTTCAGTTTCTAAGG - Intergenic
1014648748 6:124008801-124008823 ATTAACAAGTTTACTTGATATGG - Intronic
1014866009 6:126531377-126531399 ATAAACATGTTCACTTTATAGGG - Intergenic
1015372554 6:132471413-132471435 ATGAACATGGTTACTTGCTAAGG - Intronic
1015542471 6:134329335-134329357 ATTAAGAAGTTTACTTTATAGGG - Intergenic
1016405464 6:143724975-143724997 ATGAACAAGTTCACTTTCTATGG + Intronic
1016583847 6:145661429-145661451 TTAAACAAGTTCACATTCTCAGG - Intronic
1020704360 7:11524985-11525007 ATAAACACTTTCACTTTCTGTGG + Intronic
1021326884 7:19282208-19282230 ATGTGTAGGTTCACTTTCTATGG - Intergenic
1022222699 7:28329655-28329677 ATGCAAAAGTTCTCATTCTAGGG - Intronic
1022690671 7:32649309-32649331 AAGAAGATGTTCCCTTTCTAGGG + Intergenic
1022853092 7:34285470-34285492 ATGCTCAAGTTCACTTTCTATGG + Intergenic
1030205920 7:106952704-106952726 ATGAACAATTCCATTTTATAGGG - Intergenic
1032727901 7:134608774-134608796 TTGAACAAGTTTATTTTCTGCGG + Intergenic
1033053178 7:138025211-138025233 ATGAACACATTAACTCTCTATGG - Intronic
1033319223 7:140324778-140324800 ATTAAAAAGTGAACTTTCTAAGG + Intronic
1033645216 7:143296677-143296699 ATAAACGAGTTGACTCTCTAGGG - Intronic
1034143864 7:148851011-148851033 ATCTACAATTTCACCTTCTAAGG - Intronic
1034301244 7:150017193-150017215 ATGAAAAAGGTCACTTTGCATGG - Intergenic
1034697186 7:153064251-153064273 ATGAATAAGCCCACTTTCTAAGG - Intergenic
1035415274 7:158678435-158678457 ATGAACAAATTAACATTTTATGG + Intronic
1035641858 8:1190115-1190137 ATAAACAACTGCACTTTGTAGGG + Intergenic
1035646378 8:1224428-1224450 ATGTACAAGTTCATTTTTAAAGG + Intergenic
1039369992 8:36974433-36974455 ATGAATAACCTCAATTTCTAGGG + Intergenic
1040081251 8:43288571-43288593 ATAAACAACTCCACTTTGTAGGG + Intergenic
1040844904 8:51827312-51827334 ATGCACAGTTTCACTTTCCACGG + Intronic
1042473811 8:69222022-69222044 AAGAAAAACTTCACTTTCTGAGG - Intergenic
1043095600 8:75967148-75967170 ATGAATAACTTCAGTTTCTGTGG + Intergenic
1043304510 8:78777900-78777922 AAGATCAAGTTCACATTCTTCGG + Intronic
1044260650 8:90116055-90116077 ATGAACTAGTTAACCTTTTAAGG - Intergenic
1045690230 8:104752807-104752829 ATGAACAATTTCATTTTTTCAGG + Intronic
1048038493 8:130701234-130701256 ATTCACAATTTCACTTTCCATGG + Intergenic
1048395112 8:134006877-134006899 TTGAACAACTACAGTTTCTATGG + Intergenic
1050836209 9:10082098-10082120 ATGAAGAGGTTCATTTTGTATGG - Intronic
1050965702 9:11798882-11798904 ATGACCAAGTTCTCTTTTCAAGG + Intergenic
1052118967 9:24685146-24685168 ATGACCATGTTCACTGTCTATGG + Intergenic
1052671920 9:31568846-31568868 AGGAGCAAATACACTTTCTAAGG - Intergenic
1055406904 9:75984503-75984525 ATGAACTAGTTAACTTTATTAGG + Intronic
1055596540 9:77870975-77870997 ATGAACATGTGAACTTTTTAGGG + Intronic
1055898928 9:81212333-81212355 ATGAATCACTTCATTTTCTAGGG - Intergenic
1055939136 9:81632801-81632823 AAGATCAAGTTCACATTCCAAGG + Intronic
1055989804 9:82093375-82093397 ATAAACCAGTTCCCTTTGTAAGG - Intergenic
1057696345 9:97325455-97325477 ATGAAAAAATTCTCTTTCAATGG - Intronic
1057916119 9:99056412-99056434 ATGAACAAGGGCACTGTTTACGG - Intronic
1058242662 9:102585796-102585818 AAGAACAAATTCAATGTCTAAGG + Intergenic
1061567403 9:131451063-131451085 AAGAACAATTTCATTTTTTAAGG + Intronic
1186316873 X:8380374-8380396 ATGAAAAAATACACTTTCGATGG - Intergenic
1187491790 X:19759094-19759116 ATGAACAAGGTACTTTTCTAAGG + Intronic
1187621451 X:21060988-21061010 AGGCACAGGTTCACTTTCCAAGG + Intergenic
1187755764 X:22524450-22524472 ATGAAAAAGATGACTTGCTATGG + Intergenic
1188080577 X:25834777-25834799 GTGCACATATTCACTTTCTAAGG + Intergenic
1190489946 X:50971747-50971769 ATCTACAATTTCACTTTCTGTGG - Intergenic
1191171241 X:57449245-57449267 ATGTACTAGGTCAGTTTCTATGG + Intronic
1191678625 X:63817836-63817858 CTGAATAAGTTCACGTTCTGAGG - Intergenic
1197288047 X:124619399-124619421 AAGAACAAGTTAATTTTATATGG - Intronic
1199460162 X:148075277-148075299 CCAAATAAGTTCACTTTCTAGGG - Intergenic
1201622809 Y:15979423-15979445 ATGAACAATTACACCTTTTAAGG + Intergenic
1201720980 Y:17096870-17096892 AGGAACAACTTCATTTTCTCTGG - Intergenic