ID: 1016407301

View in Genome Browser
Species Human (GRCh38)
Location 6:143744148-143744170
Sequence CAGATCATCCATAGGACAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 122}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016407299_1016407301 5 Left 1016407299 6:143744120-143744142 CCTTCTTCAGTGCATACAGAGAC 0: 1
1: 0
2: 2
3: 14
4: 152
Right 1016407301 6:143744148-143744170 CAGATCATCCATAGGACAGAAGG 0: 1
1: 0
2: 0
3: 9
4: 122
1016407298_1016407301 6 Left 1016407298 6:143744119-143744141 CCCTTCTTCAGTGCATACAGAGA 0: 1
1: 0
2: 3
3: 17
4: 240
Right 1016407301 6:143744148-143744170 CAGATCATCCATAGGACAGAAGG 0: 1
1: 0
2: 0
3: 9
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016407301 Original CRISPR CAGATCATCCATAGGACAGA AGG Intronic
904820175 1:33237627-33237649 CAGATCATCATGAGGACTGAGGG - Intergenic
915351236 1:155227651-155227673 CTGACCATCCGTAGCACAGACGG + Intergenic
919411325 1:197246486-197246508 CAGACCATCTATGGGACACAGGG - Intergenic
920647333 1:207813330-207813352 CAGAACAACCATATGACATAGGG - Intergenic
922089568 1:222382732-222382754 CAGACCATCAAGAGTACAGAAGG + Intergenic
922238269 1:223737475-223737497 CTGCTCATCCATGGGACAGACGG - Intronic
923130860 1:231073530-231073552 CAAATTATCAACAGGACAGAAGG + Intergenic
923509725 1:234639917-234639939 CAGATCTTCCTAAGGAAAGAGGG - Intergenic
1064312505 10:14223962-14223984 CAGATGATCCATATTAGAGAAGG - Intronic
1064708767 10:18100735-18100757 CTGATCATCCATAAGAAACATGG - Intergenic
1071861615 10:89679882-89679904 CAGACCATCCAGAGCTCAGAAGG + Intergenic
1074138082 10:110644632-110644654 CAGATCATCCAAAAGTAAGAAGG + Exonic
1074504741 10:114059522-114059544 CATATCATCCATAACTCAGAAGG + Intergenic
1074575972 10:114669756-114669778 GATATCTTCAATAGGACAGATGG + Intronic
1084595481 11:70114310-70114332 CAGATTTTCCATATGACTGAAGG + Intronic
1085538856 11:77247157-77247179 CAGATCATTGCTAGGCCAGAAGG + Intronic
1086242118 11:84707745-84707767 CAGAGTATACATAGTACAGAGGG - Intronic
1087874534 11:103339859-103339881 CAGACCATCCCTGGGGCAGAGGG - Intronic
1094523503 12:31217213-31217235 AAGATCATCCCTAAGACACATGG + Intergenic
1095257000 12:40050516-40050538 CAGAGCACTCATTGGACAGAAGG - Intronic
1098034663 12:66289567-66289589 GACCTCATCCATGGGACAGAGGG - Intergenic
1099404591 12:82244916-82244938 CAGCCTATCCATATGACAGAGGG - Intronic
1101074263 12:101112147-101112169 CAGATCTTACATAGGAAATACGG + Intronic
1102409070 12:112701396-112701418 CAGGACAACCATAGGAGAGAGGG + Intronic
1105594304 13:21821671-21821693 CAGATCATCCCTATGAAATAAGG - Intergenic
1106104066 13:26718521-26718543 CTGACCAGCCATAGGGCAGAGGG + Intergenic
1107935096 13:45340165-45340187 CAGATGGTCAGTAGGACAGAAGG - Exonic
1109164277 13:59014196-59014218 CAGTTTATCCAGAAGACAGAGGG - Intergenic
1110974238 13:81808818-81808840 CAGCTCATCCATAGCACAATAGG + Intergenic
1113904651 13:113813547-113813569 GAGACCCTCCATCGGACAGAGGG - Exonic
1115252018 14:31358948-31358970 AAGATCATCCTGATGACAGAGGG + Exonic
1118445874 14:65850897-65850919 CACATCACCCATGGAACAGATGG + Intergenic
1120270378 14:82306366-82306388 CAGATGATCCTGAGGAAAGATGG - Intergenic
1122136428 14:99635468-99635490 CAGAGCATCCACAGGAAAGTGGG + Intergenic
1123092009 14:105746113-105746135 CAGATCATCCACAGGAGAGCAGG - Intergenic
1123968072 15:25478826-25478848 CAGATCCCCCTTAGGAAAGAAGG + Intergenic
1127064262 15:55221079-55221101 CAGATACCCCATATGACAGAAGG + Intronic
1129622660 15:77162791-77162813 CATTTCATCCATGAGACAGATGG + Intronic
1129798127 15:78393480-78393502 CAGATAATAAATAGGACAGAAGG - Intergenic
1133041212 16:3060552-3060574 CAGATCAGCATGAGGACAGAAGG + Exonic
1135528567 16:23232891-23232913 GAAATCATCCAAAGGACATAAGG + Intergenic
1137227391 16:46526949-46526971 TAGATCATCAATAGGAAATAGGG - Intergenic
1137326627 16:47444816-47444838 CAGATCATTAATTGGAAAGAAGG - Intronic
1138343801 16:56307804-56307826 CAGCTCCTCCATAGGAAGGATGG + Intronic
1139247813 16:65463519-65463541 CAGATCAGCTATAGGGCACAGGG - Intergenic
1140136550 16:72210927-72210949 AAGATCTTCCATATGCCAGAAGG + Intergenic
1141786369 16:86203505-86203527 CCCATCATCCAAAAGACAGAGGG - Intergenic
1143432668 17:6898599-6898621 CAGGTCATCAGGAGGACAGAGGG - Intronic
1143537578 17:7550350-7550372 GAGCACATCCATATGACAGAAGG - Intronic
1145286873 17:21512417-21512439 AAGATCATCCATGGGACATCTGG - Intergenic
1145390743 17:22453923-22453945 AAGATCATCCATCGGACATCTGG + Intergenic
1146053521 17:29569519-29569541 CAGATCAGCCCCAGGACAGATGG + Intronic
1146211177 17:30944991-30945013 CAGATCACCTACAGGAGAGATGG + Exonic
1146673094 17:34755507-34755529 CAGAGCAACCACAGGACACATGG + Intergenic
1147235001 17:39050807-39050829 CAGGTCATCCATTTCACAGATGG + Intergenic
1150302001 17:64054770-64054792 CAGGACATCCTTGGGACAGAAGG + Exonic
1152564190 17:81092901-81092923 CAGCTCCTCCTTAGAACAGAGGG + Intronic
1160321780 18:77902955-77902977 CACATCATCCATAGGCAGGAGGG - Intergenic
1161744126 19:6044663-6044685 CTGATCGTCCCTAGTACAGAGGG + Intronic
1163665075 19:18599464-18599486 CAGCTCATCCCCAGGCCAGAAGG + Intronic
1164449548 19:28348620-28348642 CAGCTCATCCAGAGGAAAGCAGG + Intergenic
1164720686 19:30429656-30429678 CTCATCATCTAAAGGACAGATGG - Intronic
1165502592 19:36201941-36201963 CAGATCATTCTAAGGATAGAAGG + Intronic
1167327777 19:48835958-48835980 ATGATCACCCATAGGACAGAGGG + Intronic
1168529313 19:57115014-57115036 AAGATGATCCAAAGGACAGCGGG + Intergenic
925996240 2:9295890-9295912 CAGACCATTCATAGGTCATAGGG + Intronic
929788494 2:45008202-45008224 CTGGTCATCCTCAGGACAGAGGG - Intronic
931797325 2:65723571-65723593 CAGATCACCCCTAGGACCAAAGG - Intergenic
931849067 2:66234889-66234911 CCTATCTTCCATAGGACAGGTGG - Intergenic
933182045 2:79238248-79238270 CAGCTCATCCATAGAGCAGTCGG + Intronic
935098902 2:99973480-99973502 CAGATTACCCCTAAGACAGATGG + Intronic
938364627 2:130725416-130725438 AAGATCATCCAGGGAACAGATGG + Intergenic
939757043 2:146127448-146127470 CAGATTATGCATAGGACACTAGG + Intergenic
940398855 2:153223155-153223177 CAGAGCATCAAAAGGACAGGAGG + Intergenic
944147102 2:196517728-196517750 CAGATAATCAATAGTACAGGTGG + Intronic
946045351 2:216816409-216816431 CAGATTATCCATGGGCTAGAAGG - Intergenic
947803999 2:232952043-232952065 CAGATCATCAAAAGGATAAATGG + Intronic
947890089 2:233609907-233609929 CAGATCATGCCAAGGACTGAGGG - Intergenic
1169129253 20:3156108-3156130 CAGAAAATCCATAGGAAAGCTGG + Intronic
1173182863 20:40817784-40817806 AAGCTCATCCATAGGCCAGTTGG + Intergenic
1181834538 22:25592374-25592396 CAGATCTTCAATTGGATAGATGG + Intronic
952875104 3:37938184-37938206 CAGATCACAGATAGGAGAGATGG + Intronic
953119363 3:40024820-40024842 CAGATGATCCAATGGAGAGATGG + Intronic
954572971 3:51657648-51657670 CACATCATCCGTGGGACAAAAGG + Exonic
963822084 3:149908697-149908719 AAGCTGATCTATAGGACAGAAGG + Intronic
969619563 4:8272307-8272329 CAGACCATCGAGGGGACAGAAGG + Intronic
972787388 4:42339784-42339806 CAGATTATCAATTGGACAGAAGG - Intergenic
980382366 4:132039777-132039799 CAGATCATCCATTAAACAGTTGG - Intergenic
988837104 5:35044453-35044475 CAGAGCACGCATGGGACAGAGGG - Intronic
989394144 5:40935252-40935274 CGAATCATCCAAATGACAGATGG - Intronic
993683697 5:90911893-90911915 CAGATTATACATAGGACATAAGG + Intronic
996125103 5:119716809-119716831 CAGATCAGCCATACTCCAGATGG - Intergenic
997753938 5:136376945-136376967 CAGATTATCTCTAGGAGAGATGG + Intronic
998131783 5:139655125-139655147 CAGATCAGCCCTAGGGAAGAGGG + Intronic
1001592756 5:172877692-172877714 CAGATCACCCATAACGCAGAGGG - Intronic
1002189115 5:177469726-177469748 CAGAGCAACCATTGCACAGAAGG + Intronic
1002483150 5:179516766-179516788 CTGAGCATCCCCAGGACAGAGGG + Intergenic
1002483207 5:179516970-179516992 CTGAGCATCCTCAGGACAGAGGG + Intergenic
1002483220 5:179517021-179517043 CTGAGCATCCTCAGGACAGAGGG + Intergenic
1002483233 5:179517072-179517094 CTGAGCATCCTCAGGACAGAGGG + Intergenic
1002483274 5:179517225-179517247 CTGAGCATCCTCAGGACAGAGGG + Intergenic
1003413224 6:5884381-5884403 CAGACAATCCATGGGACAGGTGG - Intergenic
1009789095 6:68377513-68377535 CAAATCATACATTGGACAAAGGG - Intergenic
1015224951 6:130846730-130846752 CAGTTCATTCAGAGGACACAGGG - Intronic
1016394539 6:143609059-143609081 CAGATAATCCATAACACAGCTGG - Intronic
1016407301 6:143744148-143744170 CAGATCATCCATAGGACAGAAGG + Intronic
1016708474 6:147141875-147141897 CAGAGCATGCAGAGGAAAGATGG - Intergenic
1020795564 7:12675108-12675130 TAGGTCATCCCTAGCACAGAAGG - Intergenic
1021565053 7:22008607-22008629 CAATCCATCCATGGGACAGAGGG - Intergenic
1023131902 7:37011851-37011873 CAAATCATCCCTGGGAAAGAGGG - Intronic
1023292457 7:38682598-38682620 AATATCAACCATAGGACATATGG - Intergenic
1027546915 7:79538800-79538822 CAGATCATACAAAGAATAGATGG + Intergenic
1032511320 7:132474932-132474954 CAGCTCATTCATAAGAGAGATGG + Intronic
1039731871 8:40288447-40288469 CAGATCCTCCAGAGGACAGCAGG - Intergenic
1047255515 8:123210697-123210719 CAGATCATTCCTAGGAGACAGGG - Intergenic
1048414749 8:134213831-134213853 CAGAAAATACAGAGGACAGAGGG - Intergenic
1050364377 9:4860621-4860643 CAAAACAGCCATATGACAGAGGG - Exonic
1050526746 9:6553060-6553082 CAGAACATCCATATGACTCATGG + Intronic
1052675955 9:31623833-31623855 CTCATCATCCACAGGAGAGAAGG - Intergenic
1055134197 9:72808142-72808164 CAGATCATCCAGGGTACTGAAGG - Intronic
1055524713 9:77119827-77119849 GAGATCATGCATGGGACTGAAGG + Intergenic
1055737477 9:79347159-79347181 CAGCTTATCCATAGTACTGAGGG - Intergenic
1056998959 9:91489864-91489886 CGGAGCTTCCATAGGACAGAAGG - Intergenic
1058951097 9:109904822-109904844 CAGATCATCTCTGTGACAGAGGG + Intronic
1059370110 9:113823747-113823769 GAGATCATCAACAGGGCAGATGG + Intergenic
1060098557 9:120816119-120816141 TAGACCATACATAGGAGAGAGGG + Exonic
1061841537 9:133361202-133361224 CCGATCATTCAGAGGACACACGG - Intergenic
1187356564 X:18578718-18578740 CAGGACAACCATTGGACAGATGG + Intronic
1189199280 X:39177877-39177899 GAGATAATCCATGTGACAGATGG - Intergenic
1196058940 X:111386698-111386720 CAGTTCATCCAGAGAAAAGAGGG - Intronic
1197885709 X:131215958-131215980 CTAGTCATCCACAGGACAGATGG + Intergenic
1199009196 X:142739148-142739170 CTGATCATCAAGAGGACATATGG - Intergenic