ID: 1016416863

View in Genome Browser
Species Human (GRCh38)
Location 6:143842897-143842919
Sequence TGCCGTAGCAACGGAGGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 80}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016416863_1016416868 -2 Left 1016416863 6:143842897-143842919 CCCCAGCCTCCGTTGCTACGGCA 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1016416868 6:143842918-143842940 CAACCGACTCCGCCCCCACCCGG 0: 1
1: 0
2: 1
3: 8
4: 106
1016416863_1016416870 3 Left 1016416863 6:143842897-143842919 CCCCAGCCTCCGTTGCTACGGCA 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1016416870 6:143842923-143842945 GACTCCGCCCCCACCCGGAGAGG 0: 1
1: 0
2: 1
3: 11
4: 129
1016416863_1016416871 4 Left 1016416863 6:143842897-143842919 CCCCAGCCTCCGTTGCTACGGCA 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1016416871 6:143842924-143842946 ACTCCGCCCCCACCCGGAGAGGG 0: 1
1: 0
2: 1
3: 8
4: 114
1016416863_1016416879 18 Left 1016416863 6:143842897-143842919 CCCCAGCCTCCGTTGCTACGGCA 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1016416879 6:143842938-143842960 CGGAGAGGGAACCTGAAACTTGG 0: 1
1: 0
2: 2
3: 19
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016416863 Original CRISPR TGCCGTAGCAACGGAGGCTG GGG (reversed) Intronic
900145166 1:1156059-1156081 TGACGAGGGAACGGAGGCTGTGG - Intergenic
900882387 1:5391419-5391441 TGCCTCCTCAACGGAGGCTGAGG - Intergenic
903548476 1:24141716-24141738 TGCCGAAGCAACACAGGCTGAGG - Intronic
905145286 1:35883257-35883279 GGCGGCGGCAACGGAGGCTGCGG + Exonic
913300890 1:117367456-117367478 TGCGGTAGCAACAGCGGCGGCGG + Exonic
915288879 1:154869762-154869784 TGCTGAAGCTGCGGAGGCTGAGG + Exonic
920342413 1:205284011-205284033 TGAAGCAGCAACGGAGGCAGCGG + Intergenic
923409455 1:233692409-233692431 TGCAGTAGCAAAGGATGGTGTGG + Intergenic
923848293 1:237762590-237762612 TGACGAAGGAAAGGAGGCTGAGG - Intronic
1067225439 10:44373235-44373257 TGCCCTGGCAGGGGAGGCTGTGG + Intronic
1070279027 10:75035434-75035456 TGCCGGAGCATTCGAGGCTGAGG - Intergenic
1076152900 10:128177889-128177911 TGCAGCAGAAACGCAGGCTGTGG - Intergenic
1077213335 11:1383429-1383451 TTCCGCAGCAGCGGAGGCCGCGG + Intergenic
1078060379 11:8039291-8039313 TGCCGGAGCCCTGGAGGCTGGGG - Intronic
1081695318 11:45105544-45105566 AGCTGTAGCAGTGGAGGCTGAGG - Intronic
1086887914 11:92225355-92225377 AGCGGTAGCAACGGCGGCTCGGG - Intergenic
1091689121 12:2583812-2583834 AGCCGCAGCAACCCAGGCTGGGG - Intronic
1104563396 12:129859012-129859034 TGCCCTAGTAACGGAGTCCGGGG + Intronic
1104669894 12:130673403-130673425 AGCTGTAGCGAAGGAGGCTGAGG + Intronic
1104948202 12:132426826-132426848 TCCCGCAGCAACGCAGGCTCAGG + Intergenic
1113075782 13:106466740-106466762 AGCAGTAGCAGAGGAGGCTGAGG - Intergenic
1120503115 14:85321691-85321713 TGCCCTAGCTATTGAGGCTGAGG - Intergenic
1128237199 15:66076532-66076554 TGCCACAGCAACAGAGGCAGTGG - Intronic
1131160341 15:90101435-90101457 TGCGTTGGCAACGGAGGCTCGGG + Intronic
1134070535 16:11256943-11256965 TGCGGAAGAAACTGAGGCTGGGG + Intronic
1137300266 16:47143026-47143048 TGCTGCGGCCACGGAGGCTGCGG - Intronic
1138616588 16:58172440-58172462 TGTAGAAGCAACTGAGGCTGAGG - Intronic
1141553385 16:84820940-84820962 AGCCTTAGCAAGGGAGGCTCTGG - Intronic
1142486189 17:248926-248948 GGGCGAAGCAACCGAGGCTGAGG + Intronic
1142613860 17:1124033-1124055 TGCCATGGCAACAGAGGCCGAGG - Intronic
1143756522 17:9071862-9071884 TGCAGTATGAATGGAGGCTGGGG + Intronic
1146017697 17:29247085-29247107 TGCCCTAGCAACTAAGGCTGGGG + Intronic
1148155439 17:45422331-45422353 TGCCTCAGCCAGGGAGGCTGAGG + Intronic
1151727314 17:75892543-75892565 TGCCATACCAAGGGAGGCTAGGG + Intronic
1152941745 17:83176442-83176464 AGCAGCAGCAGCGGAGGCTGGGG + Intergenic
1159235298 18:65663685-65663707 TGCTGTACCAACAGAGGGTGAGG + Intergenic
1160162558 18:76484989-76485011 TGCCGTAGCAACGTAAACTTGGG - Intronic
1160974324 19:1785225-1785247 TGGCGTAGAAACCAAGGCTGAGG + Exonic
1167043371 19:47036022-47036044 TGCTGGAGCAACTGGGGCTGCGG + Exonic
1168672098 19:58248356-58248378 TGCTGTGGCACCTGAGGCTGGGG - Intronic
931816954 2:65914037-65914059 TGCAGTAGCAACGGCATCTGGGG + Intergenic
934116934 2:88807564-88807586 TGAGGTTGCAACTGAGGCTGTGG - Intergenic
936160432 2:110080516-110080538 TGAGGTTGCAACTGAGGCTGTGG - Intergenic
936184232 2:110290838-110290860 TGAGGTTGCAACTGAGGCTGTGG + Intergenic
937224159 2:120358638-120358660 TGCTGGAGCAACTGAGGCTGAGG + Intergenic
945306765 2:208266356-208266378 AGCCGTTGAAGCGGAGGCTGGGG + Exonic
945848583 2:214978827-214978849 TGCCGTAGCACCCGATGTTGAGG + Exonic
948382233 2:237558866-237558888 TGCAGCAGCCACGGGGGCTGGGG + Intergenic
1170577448 20:17675138-17675160 TGCCCTTCCAGCGGAGGCTGGGG - Intronic
1172835349 20:37869737-37869759 GGCCTGAGCAAAGGAGGCTGAGG + Intronic
1174339001 20:49884428-49884450 TGCCGCAGCCATGGGGGCTGTGG + Intronic
1175886092 20:62291802-62291824 TGTGGTAGCCACGCAGGCTGGGG + Intronic
1176298824 21:5088854-5088876 TGCTGCAGAAACGGAGGCAGAGG - Intergenic
1179858202 21:44173095-44173117 TGCTGCAGAAACGGAGGCAGAGG + Intergenic
1182661311 22:31927222-31927244 TGCCATGGCAACAGAGGCAGGGG + Intergenic
954830528 3:53417684-53417706 AGCCGCAGCAACAAAGGCTGTGG - Intergenic
964430870 3:156604764-156604786 TTCTGTAGCAACACAGGCTGGGG - Intergenic
966517126 3:180830183-180830205 TGCTGCAGCAGCAGAGGCTGAGG - Intronic
967449432 3:189606627-189606649 TGGTGGTGCAACGGAGGCTGAGG - Intergenic
984405749 4:179327660-179327682 TCCTGTAGCAACAGAGCCTGAGG + Intergenic
985691113 5:1313120-1313142 TGCCGTGGCCACGGACGGTGAGG - Intergenic
986219719 5:5757079-5757101 TGCCCCAGCAAAGCAGGCTGTGG + Intergenic
987414550 5:17649227-17649249 TGCAGGAGGAACTGAGGCTGAGG - Intergenic
1001051943 5:168420747-168420769 TGCAGGAGCAGCTGAGGCTGAGG - Intronic
1003624150 6:7727259-7727281 TGCCGGAGCGCCGGGGGCTGCGG - Exonic
1007896674 6:45369176-45369198 TGTGGTAGAAAAGGAGGCTGGGG - Intronic
1016416863 6:143842897-143842919 TGCCGTAGCAACGGAGGCTGGGG - Intronic
1016509971 6:144831360-144831382 AGACGTAGCAATGGAGGCAGAGG + Intronic
1022531585 7:31070192-31070214 TGCAGAAGGAACGGAGCCTGGGG - Intronic
1024282249 7:47728962-47728984 TGCAGTGGCAGTGGAGGCTGGGG - Intronic
1030065460 7:105655780-105655802 TCCCGGAGCAACTGGGGCTGAGG - Intronic
1034405342 7:150899109-150899131 AGCCTTAGCCATGGAGGCTGGGG + Intergenic
1034658045 7:152744932-152744954 TGCTGAGGCAATGGAGGCTGAGG - Intergenic
1049603692 8:143519519-143519541 AGCCGCAGAAACGGAGGCTCAGG + Intronic
1049617373 8:143581552-143581574 TGCCCCAGAGACGGAGGCTGTGG + Intronic
1052643505 9:31200701-31200723 TGGGGTATCAACAGAGGCTGAGG + Intergenic
1053449299 9:38179912-38179934 TGCAGGAGGAACGGAGGCTCTGG + Intergenic
1053488272 9:38478461-38478483 TGCCGGAGCCACGGAGGATGAGG + Intergenic
1057668619 9:97067736-97067758 TGCCGGAGCCACGGAAGATGAGG + Intergenic
1060920905 9:127419647-127419669 TGCCTTAGCAACTATGGCTGGGG + Intergenic
1185466143 X:355461-355483 TGTCGTAGCAACGGAGGGACCGG + Intronic
1190789257 X:53683962-53683984 TGCAGTAGCCGCGGAGGCGGCGG - Exonic
1192657113 X:73003459-73003481 CGCCGCCGCAGCGGAGGCTGCGG + Intergenic
1192665007 X:73079542-73079564 CGCCGCCGCAGCGGAGGCTGCGG - Intergenic
1196556538 X:117091249-117091271 TGCTTGAGCAAGGGAGGCTGAGG - Intergenic