ID: 1016416868

View in Genome Browser
Species Human (GRCh38)
Location 6:143842918-143842940
Sequence CAACCGACTCCGCCCCCACC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 106}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016416863_1016416868 -2 Left 1016416863 6:143842897-143842919 CCCCAGCCTCCGTTGCTACGGCA 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1016416868 6:143842918-143842940 CAACCGACTCCGCCCCCACCCGG 0: 1
1: 0
2: 1
3: 8
4: 106
1016416865_1016416868 -4 Left 1016416865 6:143842899-143842921 CCAGCCTCCGTTGCTACGGCAAC 0: 1
1: 0
2: 0
3: 5
4: 50
Right 1016416868 6:143842918-143842940 CAACCGACTCCGCCCCCACCCGG 0: 1
1: 0
2: 1
3: 8
4: 106
1016416866_1016416868 -8 Left 1016416866 6:143842903-143842925 CCTCCGTTGCTACGGCAACCGAC 0: 1
1: 0
2: 1
3: 4
4: 33
Right 1016416868 6:143842918-143842940 CAACCGACTCCGCCCCCACCCGG 0: 1
1: 0
2: 1
3: 8
4: 106
1016416864_1016416868 -3 Left 1016416864 6:143842898-143842920 CCCAGCCTCCGTTGCTACGGCAA 0: 1
1: 0
2: 0
3: 4
4: 33
Right 1016416868 6:143842918-143842940 CAACCGACTCCGCCCCCACCCGG 0: 1
1: 0
2: 1
3: 8
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016416868 Original CRISPR CAACCGACTCCGCCCCCACC CGG Intronic
900887230 1:5423621-5423643 CAGCCCACTCCCACCCCACCTGG - Intergenic
901055149 1:6445810-6445832 CAACTGCCCCCACCCCCACCTGG + Exonic
901526335 1:9825121-9825143 CAGCCTCCTCCACCCCCACCTGG - Intergenic
902505975 1:16939204-16939226 CCCCCGCCCCCGCCCCCACCCGG - Intronic
903154965 1:21436872-21436894 GACCCGTCCCCGCCCCCACCCGG - Intergenic
904613192 1:31736358-31736380 CAACAGACACGGCCACCACCAGG + Exonic
905410695 1:37765972-37765994 CACCCCACTCCGCCCACCCCAGG + Intergenic
908703879 1:66930204-66930226 CACCCCACTCCGCCCCCTCGCGG - Intronic
916868618 1:168887840-168887862 TACCTGACTCAGCCCCCACCTGG + Intergenic
919979491 1:202633496-202633518 CATCCCACTCAGCCCCTACCTGG + Intronic
921189699 1:212699175-212699197 GGGCCGACTCCGCCCCCAGCTGG - Intronic
922499066 1:226083579-226083601 CCACCGGGTCCGCCCCCACGCGG + Intergenic
1063670729 10:8097695-8097717 CAACAGACGGCGACCCCACCAGG + Intergenic
1066975810 10:42367210-42367232 CAGCCCACACCCCCCCCACCCGG + Intergenic
1067060768 10:43076972-43076994 CACCCGCCTCCGGCCCCGCCTGG + Intergenic
1067833273 10:49622283-49622305 CAACCCACTCCCCCACCATCAGG + Intronic
1076413356 10:130267168-130267190 AAGCCGACTCCACCCCAACCTGG - Intergenic
1079708694 11:23653453-23653475 CCACCGAGTCCACGCCCACCTGG + Intergenic
1080213799 11:29817934-29817956 CAACCGCCCCCACCCCCACCTGG - Intergenic
1083308459 11:61772623-61772645 CATACGACTGCACCCCCACCTGG - Intronic
1090262613 11:125332275-125332297 CACCCCACCCCGCCACCACCAGG - Intronic
1093534115 12:20202529-20202551 CACCGGACCCAGCCCCCACCTGG - Intergenic
1095777341 12:46024476-46024498 CACCTGACTCAGACCCCACCCGG - Intergenic
1096491420 12:52015026-52015048 CCCCCGCCTCCGCCCCCGCCAGG - Exonic
1102057606 12:109908300-109908322 CACCTGACACAGCCCCCACCAGG - Intronic
1108363883 13:49691503-49691525 CATCCGGCTCCGCCCCTTCCCGG - Intergenic
1108791291 13:53972222-53972244 CAACTAACACTGCCCCCACCTGG + Intergenic
1109037747 13:57286910-57286932 CAGCCGAGCCCGCACCCACCGGG + Intergenic
1119383379 14:74242228-74242250 CACCCCACTCCGTCCCCATCAGG + Intronic
1122316181 14:100827238-100827260 CACCCGCCTGCGCCCCCACCAGG - Intergenic
1122887574 14:104717248-104717270 CCTCCCAGTCCGCCCCCACCGGG + Intronic
1123037715 14:105478198-105478220 GCACCCCCTCCGCCCCCACCTGG - Intronic
1123448353 15:20345333-20345355 CAACCCCCCCCACCCCCACCTGG + Intergenic
1124495098 15:30181468-30181490 CATCCCACTCAGCCCCTACCTGG + Intergenic
1124748471 15:32357177-32357199 CATCCCACTCAGCCCCTACCTGG - Intergenic
1125852870 15:42920966-42920988 AAACCGTCTCCGCCCCCCACCGG + Intergenic
1127120212 15:55765517-55765539 CATCCCACTCTGTCCCCACCAGG - Intergenic
1127332345 15:57951470-57951492 CCACAGACTCCCCCACCACCAGG - Intergenic
1128732887 15:70033127-70033149 CAACAGACTCAGCCCCCACCGGG + Intergenic
1129427212 15:75472382-75472404 CTACAGGCTCTGCCCCCACCGGG - Intronic
1129612426 15:77071168-77071190 CAACCGAGTCCCGCCCCACGCGG + Exonic
1131250235 15:90825566-90825588 CAGCCGAGTCCACGCCCACCAGG - Intergenic
1132799594 16:1745325-1745347 TCACCGACTCTGCCACCACCCGG - Intronic
1138561362 16:57802546-57802568 CAACCGGCTCCGACCCCGGCGGG + Exonic
1140267524 16:73433542-73433564 CAACCGACGCCCACCCCAGCTGG + Intergenic
1141097787 16:81175169-81175191 CAACCTCTTCCACCCCCACCTGG + Intergenic
1142068612 16:88076828-88076850 CAGCCGCCGCCGCCCCCAGCCGG + Exonic
1143247878 17:5501044-5501066 CCTCTGGCTCCGCCCCCACCCGG - Intronic
1148440413 17:47709015-47709037 CCACCGCCGCCGCCCCCGCCGGG + Exonic
1148769955 17:50060948-50060970 CAACCCCCTCCGCACACACCTGG + Intronic
1151362213 17:73595731-73595753 GAACTGACACTGCCCCCACCAGG - Intronic
1152534253 17:80941269-80941291 CAACAGACACCGCCCCCTCCAGG - Intronic
1154279709 18:12991544-12991566 CCACAGCCTGCGCCCCCACCCGG - Intronic
1161142132 19:2654144-2654166 CAGCCGGCCCCGCCCCCACCTGG - Intronic
1162141548 19:8588465-8588487 CAACCTACTCCTGCCTCACCTGG + Intronic
1163666455 19:18606157-18606179 CAACCGCGTGCGCCCCCGCCTGG + Intronic
1165071203 19:33255855-33255877 CACCCCACCCCACCCCCACCAGG - Intergenic
1167504776 19:49865451-49865473 GGACTGGCTCCGCCCCCACCGGG + Intronic
1168713447 19:58514367-58514389 CACCCCACCCCACCCCCACCTGG + Intronic
931916494 2:66962354-66962376 CAACAGTCTCCTCTCCCACCTGG - Intergenic
932809227 2:74810110-74810132 CTGCAAACTCCGCCCCCACCAGG - Intergenic
935010080 2:99126089-99126111 CTACCCACTCCTCCCACACCAGG - Intronic
936057201 2:109270128-109270150 CAGCAGTCTCAGCCCCCACCTGG + Intronic
939651049 2:144762272-144762294 TAACCGACTCTGCCCCTACTGGG - Intergenic
942277800 2:174335694-174335716 CGGCCGCCTCCGCCCTCACCCGG + Intronic
946227195 2:218270326-218270348 CACCTGACTCCGCCCCCAACTGG + Intergenic
948402088 2:237691969-237691991 CCACCGGCTCCGCCCCACCCAGG - Intronic
1169208393 20:3752598-3752620 CGACCGACTCAGCCCCAACCGGG + Exonic
1172865195 20:38090662-38090684 CAACTGCCTTCGCACCCACCAGG - Exonic
1175338101 20:58209657-58209679 CCCCCGCCCCCGCCCCCACCGGG + Intergenic
1175930533 20:62491857-62491879 CCACCCACCCCACCCCCACCAGG + Intergenic
1179981845 21:44899928-44899950 CATCCGCCTCCTCCCCCTCCCGG - Intronic
1180844077 22:18972056-18972078 CCAGCCACTCCGCACCCACCAGG + Intergenic
1184655563 22:45940356-45940378 CAGCCCACTCCACACCCACCGGG + Intronic
957270988 3:78029989-78030011 CCGCCGAGTCCGCGCCCACCTGG - Intergenic
960932634 3:122869462-122869484 CAACCAACACCGCCCCCATTGGG + Intronic
961560987 3:127730173-127730195 CAACAGTCTCCACCCCTACCGGG - Intronic
962530718 3:136277531-136277553 CACCTGACCCAGCCCCCACCTGG - Intronic
966762031 3:183427652-183427674 CAACGGACTCGGCAACCACCTGG + Intronic
969114081 4:4860404-4860426 CACCCCACCCGGCCCCCACCCGG - Intronic
974490427 4:62557484-62557506 CACCTGACACAGCCCCCACCTGG - Intergenic
985467703 5:12990-13012 CAAGCCACCCCGCCCCCGCCGGG - Intergenic
985748287 5:1660129-1660151 CCACCGACCCCGACCCCGCCTGG + Intergenic
985899872 5:2780114-2780136 GAACCGACCCTGCCCACACCTGG - Intergenic
986146033 5:5078771-5078793 CCCCCCACTCCGCCCCCAACTGG - Intergenic
991340801 5:65606444-65606466 CAACCCACTCCTCCCGCCCCCGG + Intronic
992777044 5:80097731-80097753 CCTCAGACTCAGCCCCCACCAGG - Intergenic
995106556 5:108382129-108382151 CAACTGGCTCCGCCCCCTGCCGG - Intergenic
998569948 5:143247957-143247979 AAACCTACTCAGCCCACACCTGG - Intergenic
1003076566 6:2988340-2988362 CCACCCACTCCTGCCCCACCTGG - Intronic
1003425168 6:5994382-5994404 CTCCCCACTCCACCCCCACCGGG - Intergenic
1006160476 6:32038109-32038131 CAATAGTGTCCGCCCCCACCTGG - Intergenic
1006472169 6:34235489-34235511 CAGGCGCCCCCGCCCCCACCCGG + Intergenic
1016416868 6:143842918-143842940 CAACCGACTCCGCCCCCACCCGG + Intronic
1019308305 7:346822-346844 CAACCACCACCGCCGCCACCCGG + Intergenic
1019421844 7:954362-954384 CACCCGGCCCCGCGCCCACCCGG + Intronic
1022300190 7:29095666-29095688 CCTCCGCCTCAGCCCCCACCGGG + Intronic
1026736930 7:72954753-72954775 CACCCGGCTCTGCCCCCGCCCGG + Intergenic
1027106802 7:75410310-75410332 CACCCGGCTCTGCCCCCGCCCGG - Intronic
1032841209 7:135714796-135714818 CAGCCGACTCCGGCGGCACCAGG + Intronic
1033540239 7:142349599-142349621 CAGCCGACTCCAACCCCAGCAGG - Intergenic
1039566250 8:38554328-38554350 CCACCCACTCAGCCCCCAGCTGG + Intergenic
1040501381 8:48008345-48008367 CAGCGGACTCCGCCCCCGGCGGG - Intergenic
1041089860 8:54291934-54291956 CAACCCACTCCACTCCCACCTGG - Intergenic
1046055225 8:109071101-109071123 CCACCGAGCCCGCGCCCACCGGG + Intergenic
1048370707 8:133773871-133773893 CTCCCGCCTCAGCCCCCACCAGG - Intergenic
1049380812 8:142314945-142314967 GAACCGAGGCCGACCCCACCTGG + Intronic
1049941481 9:550197-550219 CAACCGCCTCCCCTCCCCCCAGG + Intronic
1051549797 9:18315632-18315654 CCACCGATCCCGCGCCCACCTGG + Intergenic
1057199900 9:93134335-93134357 CCCCAGACTCCGCCTCCACCCGG + Intergenic
1060597274 9:124856082-124856104 CAACCAAGGCTGCCCCCACCTGG + Intronic
1062323329 9:136001103-136001125 CACCCCAGGCCGCCCCCACCAGG - Intergenic
1188870402 X:35364729-35364751 CACCCGACCCAGCCCCCACCTGG + Intergenic
1198737059 X:139798394-139798416 CAACCAACTCCTCACCCAGCTGG + Intronic
1200256484 X:154585555-154585577 CCCCCGCCTCCTCCCCCACCTGG - Intronic
1200261285 X:154618848-154618870 CCCCCGCCTCCTCCCCCACCTGG + Intronic