ID: 1016416870

View in Genome Browser
Species Human (GRCh38)
Location 6:143842923-143842945
Sequence GACTCCGCCCCCACCCGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 129}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016416867_1016416870 -6 Left 1016416867 6:143842906-143842928 CCGTTGCTACGGCAACCGACTCC 0: 1
1: 0
2: 0
3: 6
4: 42
Right 1016416870 6:143842923-143842945 GACTCCGCCCCCACCCGGAGAGG 0: 1
1: 0
2: 1
3: 11
4: 129
1016416864_1016416870 2 Left 1016416864 6:143842898-143842920 CCCAGCCTCCGTTGCTACGGCAA 0: 1
1: 0
2: 0
3: 4
4: 33
Right 1016416870 6:143842923-143842945 GACTCCGCCCCCACCCGGAGAGG 0: 1
1: 0
2: 1
3: 11
4: 129
1016416866_1016416870 -3 Left 1016416866 6:143842903-143842925 CCTCCGTTGCTACGGCAACCGAC 0: 1
1: 0
2: 1
3: 4
4: 33
Right 1016416870 6:143842923-143842945 GACTCCGCCCCCACCCGGAGAGG 0: 1
1: 0
2: 1
3: 11
4: 129
1016416863_1016416870 3 Left 1016416863 6:143842897-143842919 CCCCAGCCTCCGTTGCTACGGCA 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1016416870 6:143842923-143842945 GACTCCGCCCCCACCCGGAGAGG 0: 1
1: 0
2: 1
3: 11
4: 129
1016416865_1016416870 1 Left 1016416865 6:143842899-143842921 CCAGCCTCCGTTGCTACGGCAAC 0: 1
1: 0
2: 0
3: 5
4: 50
Right 1016416870 6:143842923-143842945 GACTCCGCCCCCACCCGGAGAGG 0: 1
1: 0
2: 1
3: 11
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016416870 Original CRISPR GACTCCGCCCCCACCCGGAG AGG Intronic
901109940 1:6785889-6785911 GGCGCCTCCCCCACCCGGACCGG + Intronic
901798578 1:11694158-11694180 GACCCAGCCCCCACCCAGGGAGG - Intronic
903193413 1:21668945-21668967 GACTCCCCACCCACCCAGGGGGG + Intronic
903810772 1:26033904-26033926 GACCCCACCCCCACCCCGAACGG + Intronic
904607098 1:31704023-31704045 CTCTCTTCCCCCACCCGGAGTGG - Exonic
909049628 1:70752687-70752709 GCCACCACCCCCACCCCGAGTGG - Intergenic
912461246 1:109833095-109833117 TAGTCCGTCCCCACCTGGAGTGG + Intergenic
912561682 1:110555714-110555736 GACTCCGCCGGCAGCCGGGGCGG + Intergenic
914171848 1:145232923-145232945 GACTCGGCCCCCGCGCGGGGCGG - Intergenic
914845647 1:151282368-151282390 GTCTCGGCCCGCACCAGGAGCGG + Exonic
915343036 1:155186581-155186603 CTCTCCTCCCCCACCTGGAGTGG + Intronic
1065092866 10:22252558-22252580 GACTCGGGCCCGGCCCGGAGGGG + Intergenic
1070756442 10:78996527-78996549 CCCTCCGCCCCCACCCCCAGCGG + Intergenic
1072809351 10:98446970-98446992 GGCTCCGGCCCCTCCCGGGGCGG - Intergenic
1073216554 10:101839896-101839918 GTCTCCGCCCTCACCCGGGTAGG + Intronic
1073249932 10:102115042-102115064 GGCCCCGCCCCCTCCCTGAGAGG + Intronic
1077318857 11:1931941-1931963 GACTGCACACCCAGCCGGAGAGG + Intronic
1077432264 11:2521788-2521810 GGCACAGCCCCCACCCGGACTGG + Intronic
1078336094 11:10464466-10464488 GACTCCACCCCTACCTGAAGAGG - Intronic
1078646064 11:13142241-13142263 GACTCCACCCCCACCTCGGGCGG + Intergenic
1083747654 11:64744665-64744687 GACTCCCCCCCCGCCCAGGGCGG - Intronic
1085267996 11:75248809-75248831 GACTCGGCTCCCACACGGATCGG - Intergenic
1085312776 11:75525982-75526004 GACTCCGCCCCGTCCGGGCGGGG - Intergenic
1085534199 11:77208308-77208330 GACTCCACTCCCAGCCGGAAGGG - Intronic
1090086493 11:123654704-123654726 GGCTCCGCCCCCGCTCGGCGCGG - Intronic
1090653451 11:128825372-128825394 GCCCCCGCCCCCAGCCAGAGTGG + Intergenic
1091601322 12:1919174-1919196 GACTCCCCCCTTTCCCGGAGAGG + Intergenic
1091636139 12:2198299-2198321 GCCTCTGCCTCCCCCCGGAGAGG + Intronic
1092165823 12:6341690-6341712 GGCTCGGCCCCCTCCCGGAGAGG + Intronic
1097195873 12:57242323-57242345 GACTCCGCCCCCACCCCCTCAGG + Intergenic
1097904238 12:64903885-64903907 CACTCAGCCCCCACAAGGAGAGG + Intergenic
1101874404 12:108589239-108589261 GACCCCACCTCCAGCCGGAGGGG - Intergenic
1102039144 12:109789442-109789464 CACTCCACCCCAACCCAGAGAGG + Intronic
1102526432 12:113515411-113515433 AGCTCAGCCCCTACCCGGAGGGG - Intergenic
1103085804 12:118061144-118061166 GCCGCCGCCGCCGCCCGGAGAGG + Intronic
1103235763 12:119371275-119371297 GACACTGCCCCCACCCCAAGTGG + Intronic
1106168652 13:27270731-27270753 GTCTCCGCCCCTTCCCGGAGCGG - Exonic
1118350838 14:64971840-64971862 GCCACCGCCTCCAGCCGGAGGGG + Intronic
1120741211 14:88110718-88110740 GATTCCCCCCCCACCTTGAGTGG - Intergenic
1122873202 14:104650833-104650855 GACTCCACCCCCACCCCTACAGG + Intergenic
1122975531 14:105169193-105169215 GGCTCGGCCCCCACGCGGGGTGG + Intergenic
1127838261 15:62808083-62808105 TACTCAGCCCACACACGGAGGGG + Intronic
1129773105 15:78215216-78215238 GACTCAGCCCTCACCAGAAGAGG - Intronic
1129862360 15:78872720-78872742 GGCCCCTCCCCCACCCGGGGGGG + Intronic
1132683645 16:1153534-1153556 GGCCCCACCCCCACCCCGAGGGG - Intronic
1133216250 16:4294189-4294211 GACACCCCCACCACCCTGAGAGG - Intergenic
1139340773 16:66266730-66266752 GACCCCACCCCCACCCCGTGAGG + Intergenic
1139570249 16:67807037-67807059 GACTCCGCCCCCGCCGCGGGGGG + Intronic
1141989474 16:87602230-87602252 GCCCCCGCCCCCTCCGGGAGTGG - Intronic
1143978136 17:10845218-10845240 GACGCCCCCCCCCCCAGGAGGGG - Intergenic
1146263696 17:31437652-31437674 GTCTCCGTCCACACCCTGAGGGG - Intronic
1147162221 17:38574889-38574911 GACTCCGCCCCCTCCGGGGCTGG - Intronic
1147919580 17:43907575-43907597 ACCTCCGCCCCCTCGCGGAGAGG - Intronic
1148337394 17:46851239-46851261 GCCTCCGCCCCATCCCGGAGAGG + Intronic
1150025252 17:61667554-61667576 GCCACCGCCCCCAGCCTGAGTGG + Intergenic
1150488835 17:65561080-65561102 GCCTCCGCCCCCGCCCGGCCCGG + Intronic
1151696252 17:75719489-75719511 GCCTCAGCCCCCACCCACAGTGG + Intergenic
1152578837 17:81157149-81157171 GACACCGCCCCCGCCAAGAGAGG + Intronic
1152823740 17:82450606-82450628 GACGCAGACCCCTCCCGGAGTGG + Exonic
1160537128 18:79600702-79600724 GACTCTTCCCCCACCCACAGGGG + Intergenic
1160537169 18:79600822-79600844 GACCCTTCCCCCACCCGCAGGGG + Intergenic
1160537651 18:79603674-79603696 CCCTCCGCCCCCGCCCTGAGAGG + Intergenic
1160972476 19:1775675-1775697 CCCTCCACCCCCCCCCGGAGGGG + Exonic
1161041862 19:2114659-2114681 GAGCCCGGCCCCACCCGGAAGGG + Intronic
1161203747 19:3029482-3029504 GTCCCCACCCCCTCCCGGAGGGG + Intronic
1161215924 19:3094995-3095017 GGCCCCGCCCCGACCCGGACAGG - Intronic
1161294057 19:3510762-3510784 GACTCCGCCCCCACAGGCACTGG + Intronic
1163176395 19:15566696-15566718 GAGACCACCCCCACCCCGAGAGG - Intergenic
1167072148 19:47227649-47227671 GACTCCCCCACCTCCCCGAGGGG + Intronic
1167344159 19:48934991-48935013 GCCACCGCCACCACCTGGAGGGG - Exonic
1167393234 19:49210690-49210712 GACTCCGCCCGCCCCTGCAGGGG + Exonic
925291488 2:2751300-2751322 GACTCCGCACCCCCCACGAGAGG + Intergenic
928134753 2:28679877-28679899 GACTCCTTCCCCACAGGGAGAGG + Intergenic
929899209 2:45986786-45986808 GGCTCCGCCCCCACCTCCAGGGG - Intronic
931739403 2:65228169-65228191 CCCGCCGCCCCCACCCGGAAGGG - Intronic
935418255 2:102841227-102841249 GACTCCGGCCCAACTCCGAGGGG + Intronic
940617358 2:156066090-156066112 GATTCCTCCCCCACCCACAGAGG + Intergenic
942361785 2:175180898-175180920 TCCTCCGCCCCCACACGGAAAGG + Intronic
946248493 2:218400017-218400039 GATTCCGGCCCCAGCCGGGGGGG + Exonic
946360437 2:219216333-219216355 GACTCCGCCCTCACCCTGCTAGG - Intronic
1168868118 20:1106174-1106196 GACTGAGGCCCCACCAGGAGAGG + Intergenic
1173548224 20:43915013-43915035 GACTCCGGCCCCGCCCGCCGGGG - Intronic
1176371772 21:6066673-6066695 GATTCCACCCACACCGGGAGGGG + Intergenic
1176550566 21:8219152-8219174 GACCCCGTCCCGGCCCGGAGCGG - Intergenic
1176569496 21:8402193-8402215 GACCCCGTCCCGGCCCGGAGCGG - Intergenic
1176577408 21:8446422-8446444 GACCCCGTCCCGGCCCGGAGCGG - Intergenic
1178707908 21:34889785-34889807 AACTCCGACCCCGCCCGGCGGGG + Intronic
1179190034 21:39115758-39115780 GTCTCCACCCCCACCAGGAGTGG + Intergenic
1179751747 21:43471866-43471888 GATTCCACCCACACCGGGAGGGG - Intergenic
1180125207 21:45785496-45785518 GACCCCCCCCCCTCCCGGACGGG - Intronic
1180212222 21:46301881-46301903 GACCCTGCCACCACCCGGAGTGG - Exonic
1183416305 22:37684307-37684329 GGCTCCACTCCCACCCAGAGTGG - Intronic
1183420811 22:37710338-37710360 GACTCCCACGCCACCGGGAGGGG + Intronic
1184164822 22:42720899-42720921 GACCCCGCCCCGGGCCGGAGGGG - Intronic
1184759620 22:46537226-46537248 GCCTCCGCATCCACCCGGCGAGG + Intergenic
1184978454 22:48079770-48079792 GACGCCGCAGCCACCAGGAGAGG + Intergenic
1185296167 22:50056386-50056408 GCCCCCGTCCCCACCCGCAGTGG - Intronic
1203255465 22_KI270733v1_random:135495-135517 GACCCCGTCCCGGCCCGGAGCGG - Intergenic
953458489 3:43062783-43062805 GCCACGGCCCCCACCCTGAGTGG + Intergenic
954364637 3:50139432-50139454 TACCCCGCCCCCACCAGGTGTGG - Intergenic
966936236 3:184711649-184711671 GAGCCCGCCCTCACCCGGAAAGG - Exonic
972484360 4:39527692-39527714 GGCTCCGCCCCTACCGCGAGCGG + Intronic
975420429 4:74158046-74158068 GGCTCCGCCCTCACCCGGGCTGG - Intronic
979122968 4:116926424-116926446 GCCACCAACCCCACCCGGAGCGG - Intergenic
986332808 5:6730089-6730111 TTCTCCGCCCCCCCCCGGAGTGG + Intronic
989118232 5:37977551-37977573 GACTCCTCCCCCATCCCAAGGGG + Intergenic
991435717 5:66596135-66596157 GGCTCCGCCCCCACCCTCCGGGG + Intergenic
992777043 5:80097726-80097748 GACTCAGCCCCCACCAGGCGAGG - Intergenic
995106555 5:108382124-108382146 GGCTCCGCCCCCTGCCGGAACGG - Intergenic
997566096 5:134887742-134887764 TACACAGCCCCCACCTGGAGAGG - Exonic
1002059696 5:176619248-176619270 GGCCCCGCCCCCACCCGGACTGG - Intergenic
1003425164 6:5994377-5994399 CACTCCACCCCCACCGGGTGAGG - Intergenic
1005159001 6:22837115-22837137 GACCCCCCCCCCTCCCGGACGGG - Intergenic
1010244802 6:73653516-73653538 GCCCCCGCCCCCGCCCGGTGGGG + Intronic
1013048232 6:106508836-106508858 GACTCCTCCCCCCCTCAGAGGGG - Intergenic
1016416870 6:143842923-143842945 GACTCCGCCCCCACCCGGAGAGG + Intronic
1019285978 7:223306-223328 GACTCAGCACCCACCCGCCGTGG - Intronic
1019301621 7:307059-307081 GTCTCCAACCCCACCTGGAGAGG - Intergenic
1019579321 7:1752269-1752291 GACCCCGACCCCACCCAGAGGGG + Intergenic
1023435221 7:40134905-40134927 GACCCCGCCCCCGCCGGGCGGGG - Intergenic
1025032978 7:55572380-55572402 GACTCGGCCCCCGCGCGGGGCGG + Exonic
1034434419 7:151056534-151056556 GACTCCGACCCCAGCCTGAGGGG + Intronic
1034585873 7:152091662-152091684 GCCACCGCCCCCAGCCGGAGAGG + Intronic
1036032864 8:4992263-4992285 GATTCCGCCCCCACGCGGGTGGG - Intronic
1036195284 8:6708522-6708544 GCCTCCGCCCCCAGCCGCATGGG - Exonic
1036797978 8:11769712-11769734 ATCTCCGCCCCCAGCTGGAGCGG + Intronic
1037348233 8:17922767-17922789 GAATCCGCCCCCACCCGCCCAGG - Intergenic
1040501380 8:48008340-48008362 GACTCCGCCCCCGGCGGGCGCGG - Intergenic
1044934256 8:97277837-97277859 GCCTCCGCCGCCACCATGAGCGG - Exonic
1045115396 8:98974491-98974513 GACCTGTCCCCCACCCGGAGAGG - Intergenic
1046838570 8:118830600-118830622 GACTCCTCCCTGACCCTGAGTGG + Intergenic
1047499624 8:125431123-125431145 GCCTCCGCCGGCCCCCGGAGCGG - Exonic
1048345242 8:133570916-133570938 GAATCCGCCCCAACCCCGTGAGG - Intronic
1049799016 8:144509247-144509269 GCCTCTGACCCCACGCGGAGGGG + Exonic
1055623576 9:78150238-78150260 GACCCCGGCCCCTCCTGGAGTGG - Intergenic
1057199905 9:93134340-93134362 GACTCCGCCTCCACCCGGGGCGG + Intergenic
1060281394 9:122218169-122218191 GACTCCGCTGCCTCCTGGAGGGG - Intronic
1062425190 9:136503004-136503026 CACTCCGCCCCCACCTGCGGCGG - Intronic
1062578670 9:137220303-137220325 GCTTCCGGCCCCACCCCGAGTGG - Exonic
1203471861 Un_GL000220v1:118630-118652 GACCCCGTCCCGGCCCGGAGCGG - Intergenic
1185723910 X:2404199-2404221 GGCCCCGCCCCCACCCCCAGAGG + Intronic
1187226049 X:17375997-17376019 GACTCAGCCGCCGCACGGAGAGG + Exonic