ID: 1016416871

View in Genome Browser
Species Human (GRCh38)
Location 6:143842924-143842946
Sequence ACTCCGCCCCCACCCGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 114}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016416863_1016416871 4 Left 1016416863 6:143842897-143842919 CCCCAGCCTCCGTTGCTACGGCA 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1016416871 6:143842924-143842946 ACTCCGCCCCCACCCGGAGAGGG 0: 1
1: 0
2: 1
3: 8
4: 114
1016416866_1016416871 -2 Left 1016416866 6:143842903-143842925 CCTCCGTTGCTACGGCAACCGAC 0: 1
1: 0
2: 1
3: 4
4: 33
Right 1016416871 6:143842924-143842946 ACTCCGCCCCCACCCGGAGAGGG 0: 1
1: 0
2: 1
3: 8
4: 114
1016416865_1016416871 2 Left 1016416865 6:143842899-143842921 CCAGCCTCCGTTGCTACGGCAAC 0: 1
1: 0
2: 0
3: 5
4: 50
Right 1016416871 6:143842924-143842946 ACTCCGCCCCCACCCGGAGAGGG 0: 1
1: 0
2: 1
3: 8
4: 114
1016416867_1016416871 -5 Left 1016416867 6:143842906-143842928 CCGTTGCTACGGCAACCGACTCC 0: 1
1: 0
2: 0
3: 6
4: 42
Right 1016416871 6:143842924-143842946 ACTCCGCCCCCACCCGGAGAGGG 0: 1
1: 0
2: 1
3: 8
4: 114
1016416864_1016416871 3 Left 1016416864 6:143842898-143842920 CCCAGCCTCCGTTGCTACGGCAA 0: 1
1: 0
2: 0
3: 4
4: 33
Right 1016416871 6:143842924-143842946 ACTCCGCCCCCACCCGGAGAGGG 0: 1
1: 0
2: 1
3: 8
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016416871 Original CRISPR ACTCCGCCCCCACCCGGAGA GGG Intronic
900175655 1:1290336-1290358 ACTCAGCCCCCGCCGGCAGAGGG - Exonic
900177824 1:1298536-1298558 ACCCCGCCCCCACCTGAGGAAGG + Intronic
900343413 1:2199316-2199338 ACTCAGCCCCCACCCAGGGGCGG + Intronic
900917820 1:5650839-5650861 CCTCGGCCCCCACCGGCAGAAGG + Intergenic
901613369 1:10517316-10517338 ACTCTGCCCCCAATAGGAGAGGG - Intronic
902514158 1:16980761-16980783 ACACCCCCCCCCCCAGGAGATGG - Exonic
905916290 1:41686681-41686703 ACTCCATCCCCACCCCCAGAAGG - Intronic
907275962 1:53316801-53316823 GCTCTGGTCCCACCCGGAGAGGG - Intronic
911527431 1:99004344-99004366 ACTGCGCCCCAACCCTTAGAGGG + Intronic
914251699 1:145927208-145927230 ATTCCGCCCCCTTCAGGAGAAGG - Intergenic
915406652 1:155665057-155665079 ACTGCGCCCGGCCCCGGAGATGG + Intronic
915925045 1:160010971-160010993 ACTCCACCACCACCTTGAGAAGG + Intergenic
919252978 1:195083220-195083242 ACTCCCCCCACACCCAGTGAGGG + Intergenic
923039012 1:230306386-230306408 CCTCCACCCCCACCACGAGAGGG - Intergenic
924438217 1:244064621-244064643 ACTCCACTCTCACCAGGAGAAGG + Intergenic
1065552853 10:26886969-26886991 ACTCCTCCCCCACAAGCAGATGG + Intergenic
1072286577 10:93921442-93921464 GCTCCGCCACCTCCCGGTGAGGG + Intronic
1077107622 11:848855-848877 ACACCTCCCACAGCCGGAGATGG - Intronic
1077318858 11:1931942-1931964 ACTGCACACCCAGCCGGAGAGGG + Intronic
1078336093 11:10464465-10464487 ACTCCACCCCTACCTGAAGAGGG - Intronic
1081775292 11:45671976-45671998 ACTCCCCCTCCTCCCGCAGAGGG - Intergenic
1088496765 11:110439210-110439232 ACTTCCCCCCAACCCCGAGACGG + Intronic
1092165824 12:6341691-6341713 GCTCGGCCCCCTCCCGGAGAGGG + Intronic
1095777339 12:46024470-46024492 ACTCAGACCCCACCCGGTTATGG - Intergenic
1095957037 12:47812973-47812995 ACCCCACCCCCACCGGGCGAGGG - Intronic
1102434305 12:112908772-112908794 ACTCCACCCCCTCCCCGAGCTGG - Exonic
1103478833 12:121237928-121237950 ACTCGGCCTCCAGCTGGAGAGGG + Exonic
1103924922 12:124418402-124418424 ACCCCGCCCCCAACCCGTGATGG + Intronic
1105443219 13:20432242-20432264 GCTGGTCCCCCACCCGGAGACGG - Exonic
1114619027 14:24084006-24084028 ACTCCCACCCCACCCCCAGAAGG + Intronic
1115466179 14:33716804-33716826 GCGCCGCCCCCACCCGACGATGG + Intronic
1119479763 14:74951997-74952019 CCTCCACCCCCTCCCGGAGCAGG - Intronic
1128068195 15:64776768-64776790 CCTCCGCCCCGTCCAGGAGAAGG - Intergenic
1129773104 15:78215215-78215237 ACTCAGCCCTCACCAGAAGAGGG - Intronic
1129880664 15:79004242-79004264 ACTCCGAGCCCCACCGGAGACGG - Intronic
1133216249 16:4294188-4294210 ACACCCCCACCACCCTGAGAGGG - Intergenic
1133840342 16:9402372-9402394 AGTCCTCCACCACCCAGAGAAGG - Intergenic
1141705296 16:85661459-85661481 CCTCCGCCGCCACCACGAGAGGG + Exonic
1142024708 16:87806252-87806274 ACTCCCTCCCCACACGGAGGAGG + Intergenic
1142706491 17:1698199-1698221 CCACCGCACCCAGCCGGAGATGG - Intergenic
1143361471 17:6375010-6375032 AAGCCCCCTCCACCCGGAGAAGG + Intergenic
1143893120 17:10117437-10117459 ACTCAGCCCCCACAGGGAGTTGG + Intronic
1146797859 17:35795476-35795498 GCGCCGCCCCCGCACGGAGAGGG + Exonic
1146951257 17:36908183-36908205 ACTCCCACCCCACCCAGGGAAGG + Intergenic
1147166278 17:38595220-38595242 CCGCCGCCCCGACCCCGAGATGG + Intronic
1147685377 17:42283881-42283903 ACTCCAGCCCCCACCGGAGAAGG - Intergenic
1148191391 17:45681145-45681167 GCTCTGCCCCCACCTGCAGAAGG - Intergenic
1148749141 17:49934806-49934828 ACTCACCCCCCAGCCAGAGAAGG + Intergenic
1148808128 17:50274398-50274420 GCTCCGCCCCCATCCCGAGGCGG + Intronic
1150124503 17:62627673-62627695 ACTTCGTCCCGACCCGGAGGAGG + Exonic
1152456790 17:80421510-80421532 ACCCCGCCCCCACCGGGACCTGG - Intronic
1152578838 17:81157150-81157172 ACACCGCCCCCGCCAAGAGAGGG + Intronic
1153236647 18:2994792-2994814 ACACCGCCCCCACCCGCCGCCGG - Intronic
1153712236 18:7811360-7811382 ACTCTCTCCCCACCCCGAGATGG + Intronic
1156350324 18:36297335-36297357 ACTTCTTCCCCACCCGGAGAAGG - Intergenic
1160537653 18:79603675-79603697 CCTCCGCCCCCGCCCTGAGAGGG + Intergenic
1161978327 19:7618155-7618177 ACTCCAGCCCCACCCAGACACGG - Exonic
1162566714 19:11448721-11448743 TCTCGGGCCCCACCCGCAGATGG - Intronic
1163515602 19:17761662-17761684 ACTTCCCCCCCGCCCTGAGACGG + Intronic
1164990298 19:32677723-32677745 TCTCCCCAGCCACCCGGAGATGG + Exonic
1165394220 19:35555499-35555521 CCTGCGCACCCACCCCGAGATGG - Exonic
1167269675 19:48499783-48499805 CCGCCACCCCCACCCCGAGACGG - Exonic
1167648966 19:50719467-50719489 ACCCCCCACCCCCCCGGAGACGG + Intergenic
925291489 2:2751301-2751323 ACTCCGCACCCCCCACGAGAGGG + Intergenic
929174290 2:38960776-38960798 CCTCCGCCTCCACCCGCCGACGG - Intronic
934707523 2:96494578-96494600 ACTCTGCCTCCACCCTAAGAAGG - Intergenic
940617359 2:156066091-156066113 ATTCCTCCCCCACCCACAGAGGG + Intergenic
944770828 2:202912543-202912565 CCTCCGCCCCCAGCCGCAGCCGG + Intronic
945130757 2:206569578-206569600 ACTCTGCCTCCATCCTGAGACGG - Intronic
948459582 2:238122690-238122712 CCTCAGCCCCCTCCCTGAGATGG - Intronic
948770949 2:240251034-240251056 CCTCCGCCCCCACCCATAAAGGG + Intergenic
1171099695 20:22371469-22371491 ACTCCACCCTCACCGGGAGGAGG + Intergenic
1175834586 20:61985326-61985348 CCTCAGCCCCCACCAGGAGTTGG - Intronic
1180570937 22:16718134-16718156 CCTGCGCCACCACCAGGAGAAGG - Intergenic
1184578839 22:45398357-45398379 ACTCAGCCCCCAGCAGAAGAGGG - Intronic
1184655567 22:45940362-45940384 ACTCCACACCCACCGGGACAGGG + Intronic
1184878215 22:47288847-47288869 CCTCCGCCCTAACCCGGAGCTGG + Intergenic
954364636 3:50139431-50139453 ACCCCGCCCCCACCAGGTGTGGG - Intergenic
955928432 3:64030899-64030921 CTTCCGGTCCCACCCGGAGATGG + Intergenic
957107258 3:75906723-75906745 GCTGCGCCACCACCCGGAGGAGG + Exonic
958924563 3:100144133-100144155 ACTCCTCCCCCGCACAGAGATGG - Intronic
961211853 3:125131731-125131753 ACACTGTCCCCACCCTGAGAAGG - Intronic
962003527 3:131325435-131325457 ACTCCCTTCCCACCCGCAGAGGG - Intronic
966479775 3:180393963-180393985 CCCCTACCCCCACCCGGAGATGG + Intergenic
966595334 3:181720341-181720363 GACCCGCCCCCACCCGCAGAAGG + Intergenic
967228739 3:187317937-187317959 ACTCCACACCCACCCTGACAGGG + Intergenic
969452354 4:7281823-7281845 ACCCAGCCCCCACCCACAGACGG - Intronic
980978494 4:139633763-139633785 ACTCCTCCCCCACCTGAAGATGG + Intergenic
985256516 4:188075705-188075727 ACTCCTCCCCCACCCTCAGGAGG + Intergenic
992777042 5:80097725-80097747 ACTCAGCCCCCACCAGGCGAGGG - Intergenic
997425431 5:133799627-133799649 ACCCTGCCCCCAGCAGGAGATGG + Intergenic
997566095 5:134887741-134887763 ACACAGCCCCCACCTGGAGAGGG - Exonic
1003425163 6:5994376-5994398 ACTCCACCCCCACCGGGTGAGGG - Intergenic
1008899559 6:56595779-56595801 ACCCCCACCCCACCCCGAGAAGG + Intronic
1011719534 6:90141183-90141205 ACTGCTCCCCCACCCAGGGATGG + Intronic
1016416871 6:143842924-143842946 ACTCCGCCCCCACCCGGAGAGGG + Intronic
1018890486 6:167978176-167978198 CCTCAGCCTCCAGCCGGAGAAGG - Intergenic
1019287797 7:232225-232247 ACTCCCCATCCACCTGGAGAGGG + Intronic
1019488815 7:1301604-1301626 GCTCAGTCCCCACCCGGGGAGGG + Intergenic
1024088695 7:45918274-45918296 ACCCCACCCCCACCCAGGGAAGG - Intronic
1026631261 7:72040090-72040112 ACCCCTTCCCCACCCTGAGAAGG + Intronic
1027526053 7:79270097-79270119 CCTGCGGCCCCACCCAGAGAAGG + Intronic
1031585976 7:123532913-123532935 CCTCCGCCCCCAGCCGCAGCCGG - Exonic
1033413140 7:141138508-141138530 CCTCCACCCCCACCCTCAGAAGG - Intronic
1036784853 8:11679502-11679524 ATTCCGCCGCCAGCCTGAGAGGG - Intronic
1037776445 8:21838837-21838859 ACTCCCACCCCACCCTGAGCAGG - Intergenic
1038040765 8:23722422-23722444 ACCCCGCCCCCACCCAGAGAAGG - Intergenic
1041971864 8:63752613-63752635 AGTGAGCCCCCACCCAGAGAAGG + Intergenic
1045115395 8:98974490-98974512 ACCTGTCCCCCACCCGGAGAGGG - Intergenic
1049936205 9:504174-504196 ACCCCCGCCCCAGCCGGAGATGG + Intronic
1052031800 9:23637382-23637404 ACTACGCTCCCACCTGGAAAAGG - Intergenic
1057199906 9:93134341-93134363 ACTCCGCCTCCACCCGGGGCGGG + Intergenic
1061265659 9:129503531-129503553 CCTCCACCCCCAGCTGGAGATGG + Intergenic
1061275874 9:129569161-129569183 AGCCCGCGCCCACCCGGAGCCGG - Intergenic
1061734676 9:132645841-132645863 ACTGCGGCCCCACGTGGAGATGG - Intronic
1061844915 9:133382114-133382136 TCCCCACCTCCACCCGGAGAGGG + Intronic
1062134005 9:134915191-134915213 ACCACGTCCCCACACGGAGAGGG + Intronic
1062513350 9:136920171-136920193 ATTCGGCTCCCACCCGGGGACGG - Intronic
1062526026 9:136978457-136978479 ACTTCCCCCTCCCCCGGAGATGG - Intronic
1188071748 X:25726510-25726532 ACTCCGCCCCAGCCCAGAGCAGG + Intergenic
1190170391 X:48107800-48107822 TCTCCGCCCCCACTTTGAGAAGG + Intergenic
1192232887 X:69278120-69278142 ACCCCGCCCCCAACCGGGGCTGG + Intergenic
1195551573 X:106177245-106177267 GCTCCGCCCCCTCCCAGTGATGG - Exonic
1198616656 X:138465218-138465240 CCCCCGCCCCCAACCCGAGATGG + Intergenic