ID: 1016417779

View in Genome Browser
Species Human (GRCh38)
Location 6:143851120-143851142
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016417773_1016417779 22 Left 1016417773 6:143851075-143851097 CCTAAGGCAAGAGAACGTGAATA 0: 1
1: 0
2: 1
3: 17
4: 161
Right 1016417779 6:143851120-143851142 CCTGCCCAGAAGGAAGGGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr