ID: 1016423302

View in Genome Browser
Species Human (GRCh38)
Location 6:143907944-143907966
Sequence TGATTTTTGCAGATGGTGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016423299_1016423302 -5 Left 1016423299 6:143907926-143907948 CCTTAATCCATCTTGAGTTGATT 0: 313
1: 620
2: 553
3: 434
4: 573
Right 1016423302 6:143907944-143907966 TGATTTTTGCAGATGGTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016423302 Original CRISPR TGATTTTTGCAGATGGTGTA AGG Intronic
No off target data available for this crispr