ID: 1016423302 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:143907944-143907966 |
| Sequence | TGATTTTTGCAGATGGTGTA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1016423299_1016423302 | -5 | Left | 1016423299 | 6:143907926-143907948 | CCTTAATCCATCTTGAGTTGATT | 0: 313 1: 620 2: 553 3: 434 4: 573 |
||
| Right | 1016423302 | 6:143907944-143907966 | TGATTTTTGCAGATGGTGTAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1016423302 | Original CRISPR | TGATTTTTGCAGATGGTGTA AGG | Intronic | ||
| No off target data available for this crispr | |||||