ID: 1016425259

View in Genome Browser
Species Human (GRCh38)
Location 6:143929258-143929280
Sequence CTCAACAAACAAGGCATAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7976
Summary {0: 5, 1: 102, 2: 521, 3: 1556, 4: 5792}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016425259_1016425263 -9 Left 1016425259 6:143929258-143929280 CCTTCTATGCCTTGTTTGTTGAG 0: 5
1: 102
2: 521
3: 1556
4: 5792
Right 1016425263 6:143929272-143929294 TTTGTTGAGGGCATCATGATAGG No data
1016425259_1016425264 -5 Left 1016425259 6:143929258-143929280 CCTTCTATGCCTTGTTTGTTGAG 0: 5
1: 102
2: 521
3: 1556
4: 5792
Right 1016425264 6:143929276-143929298 TTGAGGGCATCATGATAGGATGG 0: 1
1: 0
2: 0
3: 11
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016425259 Original CRISPR CTCAACAAACAAGGCATAGA AGG (reversed) Intronic
Too many off-targets to display for this crispr