ID: 1016425263

View in Genome Browser
Species Human (GRCh38)
Location 6:143929272-143929294
Sequence TTTGTTGAGGGCATCATGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016425259_1016425263 -9 Left 1016425259 6:143929258-143929280 CCTTCTATGCCTTGTTTGTTGAG 0: 5
1: 102
2: 521
3: 1556
4: 5792
Right 1016425263 6:143929272-143929294 TTTGTTGAGGGCATCATGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016425263 Original CRISPR TTTGTTGAGGGCATCATGAT AGG Intronic
No off target data available for this crispr