ID: 1016430154

View in Genome Browser
Species Human (GRCh38)
Location 6:143974822-143974844
Sequence GTAACTCAGTAGAGGTTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 98}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016430150_1016430154 -3 Left 1016430150 6:143974802-143974824 CCTTATATAATGATCACCCTGTA 0: 1
1: 0
2: 0
3: 7
4: 121
Right 1016430154 6:143974822-143974844 GTAACTCAGTAGAGGTTCTCTGG 0: 1
1: 0
2: 0
3: 8
4: 98
1016430149_1016430154 19 Left 1016430149 6:143974780-143974802 CCTAGGCTTATGAGTAGAACTTC 0: 1
1: 0
2: 1
3: 5
4: 91
Right 1016430154 6:143974822-143974844 GTAACTCAGTAGAGGTTCTCTGG 0: 1
1: 0
2: 0
3: 8
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016430154 Original CRISPR GTAACTCAGTAGAGGTTCTC TGG Intronic
906280611 1:44550786-44550808 GCAACTCAGTGGAGATGCTCAGG + Intronic
906456322 1:46000354-46000376 GCCACCCAGTGGAGGTTCTCTGG - Intronic
908643102 1:66246915-66246937 ATAACCCAGTGGAGGTTGTCAGG + Intronic
909943903 1:81641268-81641290 GAAAATCAGTAGGGGTTTTCAGG + Intronic
911999190 1:104809104-104809126 GTAAATCAGTACAGCTTCTATGG - Intergenic
913999677 1:143682909-143682931 GCAACTGAGTAGAACTTCTCAGG + Intergenic
914194852 1:145441834-145441856 GTAACTGAGTAGAACTTCTCAGG + Intergenic
914375713 1:147072004-147072026 GTAACTGAGTAGAACCTCTCAGG - Intergenic
914476126 1:148024401-148024423 GTAACTGAGTAGAACTTCTCAGG + Intergenic
921509874 1:216015198-216015220 ATAACCTAGCAGAGGTTCTCAGG - Intronic
923080612 1:230650297-230650319 GTAAATTAGTACAGGTTCTATGG - Intronic
1070403515 10:76074605-76074627 GTAAGTCAGAGGAGGTTCTGGGG + Intronic
1072787046 10:98290931-98290953 GTAACTCATGAGAGGGACTCTGG - Intergenic
1086152185 11:83624151-83624173 GTGGCTCAGAAGAGGTTTTCTGG + Intronic
1087301915 11:96446076-96446098 GTTACTTTCTAGAGGTTCTCGGG + Intronic
1090214889 11:124953363-124953385 GTATCTCAGTGCAGCTTCTCTGG + Intergenic
1092089220 12:5790354-5790376 GAAATTCAGGAGAGGATCTCAGG - Intronic
1092444363 12:8540146-8540168 GCAACTCAGTAGAGTTTGTATGG + Intronic
1095410237 12:41913368-41913390 GTAACTCAGGAGAGTTTATGAGG - Intergenic
1096211566 12:49770124-49770146 GAAACTAAGTACAGGTTCTGAGG + Intergenic
1101425188 12:104582464-104582486 GTAACTCAGTAAAGGTGATGGGG - Intronic
1102361779 12:112294325-112294347 ATAACTCAGTAGAGAATTTCAGG + Intronic
1107958060 13:45535977-45535999 GTAACTCATTAGACGTACTGAGG + Exonic
1111463407 13:88575963-88575985 CTGCCTTAGTAGAGGTTCTCTGG + Intergenic
1112231199 13:97590603-97590625 GTAACTCAGTAAAGTTTCTAGGG - Intergenic
1112624570 13:101089267-101089289 GTAACTCAGTAGGTGAACTCAGG - Intronic
1114576932 14:23723973-23723995 GAAGGTCAGTGGAGGTTCTCAGG + Intergenic
1120541337 14:85754412-85754434 GTAACTCAGAAAATGTTTTCCGG - Intergenic
1120843273 14:89105363-89105385 GTAACTCAGAAGAGCATCTGTGG + Intergenic
1123106786 14:105845507-105845529 GTATCTCAGGGAAGGTTCTCTGG + Intergenic
1125907280 15:43404570-43404592 GTAACTCAGTAGACTTTTTAAGG + Exonic
1126351170 15:47746241-47746263 GTGCCTCATCAGAGGTTCTCAGG - Intronic
1128520164 15:68369883-68369905 GTAACTAAGTTAAGGTTCTTGGG + Intronic
1129605376 15:77022502-77022524 GAGACACAGTAGAGGTGCTCAGG + Intronic
1132882839 16:2170069-2170091 GAAGCTCAGCCGAGGTTCTCTGG + Intronic
1133472403 16:6088135-6088157 GTAAATCAGAATAGGTTCTATGG - Intronic
1133858970 16:9576238-9576260 GTAAGTCAGTAGCTCTTCTCAGG - Intergenic
1145090084 17:19978676-19978698 GTAACTCAATAAATGTTCGCTGG + Intergenic
1146595216 17:34162471-34162493 GTAACTCAGCCAAGATTCTCTGG - Intronic
1147524645 17:41210158-41210180 GAAACTCATTACAGCTTCTCAGG + Intronic
1149063275 17:52449661-52449683 GTAACTCAGAAGAGGTTCAAAGG + Intergenic
1160843990 19:1158703-1158725 TTACCTCAGCCGAGGTTCTCCGG + Intronic
1162135307 19:8551672-8551694 GTAACTCAGGAGGGTTTCTGGGG + Intronic
1163600697 19:18247606-18247628 ATTTCTCAGTAGAGGGTCTCTGG + Intronic
1164411698 19:28011662-28011684 GTAACTGAGTTAAGGGTCTCAGG + Intergenic
1167513065 19:49906969-49906991 GTAACTGACTAGAGTTACTCTGG + Intronic
925218536 2:2118485-2118507 ATATCTGAGTAGAGTTTCTCTGG - Intronic
925499467 2:4487361-4487383 CTAACTCAGTAAAGTTTCTAGGG - Intergenic
926744283 2:16137915-16137937 GTATTTCAGTAGGTGTTCTCTGG + Intergenic
926984278 2:18604791-18604813 GTTACTCTGTAGAGCTTCTCCGG + Intergenic
928236335 2:29544741-29544763 GTAACTCAGAGGAGGTTTCCAGG - Intronic
931847429 2:66218946-66218968 GAAACTCAGGAGAGGAACTCAGG + Intergenic
932808663 2:74805615-74805637 GTAACCCAGAAGAGGTGCTCAGG + Intergenic
933250782 2:80026064-80026086 GTAATTCAGATGAGGTTCTTGGG + Intronic
937766548 2:125667732-125667754 GAAACTAAGTGGAGGTTCTGGGG - Intergenic
937791672 2:125968830-125968852 GTAACTCAGCAGTGGGTGTCCGG + Intergenic
941281808 2:163561186-163561208 GTAACTAAGTGAAGGATCTCGGG - Intergenic
948002310 2:234578239-234578261 GTGACTCAGTCAAGGTTCACTGG - Intergenic
1169580152 20:7013080-7013102 TTAACTCAGTACAGTTTCTCAGG + Intergenic
1172225482 20:33302620-33302642 GTAACACAGGACAGGTTCTAGGG + Intronic
1177959955 21:27651292-27651314 GTATCTCAGGAAAGGTTCTAAGG - Intergenic
1177984591 21:27958815-27958837 GTCACTCAGTAGTGTTTCACTGG + Intergenic
1182432134 22:30305599-30305621 GCAGCTCAGAGGAGGTTCTCAGG + Intronic
1183164613 22:36138527-36138549 GTGACTTAGGAGAGGTTCTGGGG + Intergenic
1183170915 22:36187677-36187699 GTGACTTAGGAGAGGTTCTGGGG + Intergenic
1183322231 22:37172153-37172175 GCACCTCAGTTGAGGCTCTCTGG + Intronic
959458471 3:106593174-106593196 GAATCTCAGTAGAGATTCTTTGG + Intergenic
961346969 3:126269225-126269247 GTCACTCAGTAGAGGTGTGCTGG + Intergenic
962814137 3:138983402-138983424 CTAACTCAGGACAGGTTCCCAGG - Intergenic
964399699 3:156286052-156286074 GTTTCTCAGTGGAGGTTCTCTGG + Intronic
965498867 3:169432870-169432892 GCAACTAAATAGTGGTTCTCAGG + Intronic
965829570 3:172769373-172769395 AGAACTCAGTAGATGATCTCAGG + Intronic
976688689 4:87844843-87844865 TTAACTCAATAGAGGTTTACTGG - Intronic
983888916 4:173010941-173010963 GTAACTTAGTACAGGTACTATGG - Intronic
989189444 5:38655713-38655735 TTAACTCAGTCTAGCTTCTCTGG - Intergenic
992924477 5:81567564-81567586 GTAACCCAGTAGAGACTGTCTGG - Intronic
993018733 5:82564916-82564938 GGACCTTAGTAGAGGTTTTCAGG - Intergenic
996043552 5:118844066-118844088 GCAAATCAGCAGAGGTCCTCAGG + Intronic
1003361219 6:5427514-5427536 GAAACTGAGCAGAGGATCTCAGG + Intronic
1005007936 6:21309000-21309022 GTAACTGAGGACAGATTCTCTGG - Intergenic
1008977561 6:57445772-57445794 GTAACTACCTAGAGATTCTCAGG - Intronic
1009165701 6:60338726-60338748 GTAACTACCTAGAGATTCTCAGG - Intergenic
1013752859 6:113427118-113427140 ATAATTCAGTAGAGGTTTTGGGG + Intergenic
1016430154 6:143974822-143974844 GTAACTCAGTAGAGGTTCTCTGG + Intronic
1017405635 6:154115698-154115720 GTTAGACAGTAGAGGTTCTGAGG + Intronic
1018584537 6:165341741-165341763 GTAACTCTGTATAGGTGCTATGG + Intronic
1020230656 7:6315901-6315923 TCAACTCAGTAGAAGTTCTAAGG - Intergenic
1023057822 7:36303904-36303926 GAAACTCAATAAAGCTTCTCTGG + Intergenic
1026097680 7:67359307-67359329 GTTGCTCAGTAAAAGTTCTCAGG + Intergenic
1031797665 7:126196728-126196750 GTAACTAAGTTGAGGTACTATGG - Intergenic
1033177191 7:139135617-139135639 GTAAGTCTGCAGAGGTGCTCAGG + Intronic
1033711310 7:143949475-143949497 GTAACTAAGTAAAGGATATCAGG + Intergenic
1042150922 8:65783114-65783136 GTAAGTCAGTAAAGGTTTTGGGG + Intronic
1044069134 8:87734426-87734448 ATAACTCAGTAGATGTTTACAGG + Intergenic
1047616998 8:126570907-126570929 GCAACTGAGCAGAGGTACTCAGG - Intergenic
1052575778 9:30289138-30289160 GAAACTCAGTAAAGGTCCTGAGG - Intergenic
1053671012 9:40361501-40361523 GTAACACAGTTGTGGTTTTCAGG - Intergenic
1054382130 9:64501562-64501584 GTAACACAGTTGTGGTTTTCAGG - Intergenic
1054513601 9:66014800-66014822 GTAACACAGTTGTGGTTTTCAGG + Intergenic
1060956613 9:127645705-127645727 GTAATTCAGCAGAGTTTATCAGG + Intronic
1186662871 X:11687114-11687136 GTAACTCAGTTGTGGATCTTAGG + Intergenic
1190401583 X:50041262-50041284 GTAATTCAGTAGAACTTTTCTGG + Intronic
1190762771 X:53450449-53450471 GTTACTCTGTAGAGGTTTACTGG - Intergenic
1191147097 X:57178458-57178480 GTTACCCAGAAGAGGTACTCTGG + Intergenic
1192377940 X:70583792-70583814 GTAAATCAGTAGAGCTTCCATGG + Intronic
1194577264 X:95627970-95627992 GGAACTCAGTAGGTGGTCTCTGG - Intergenic
1196119984 X:112039530-112039552 CTAACTCAGCAGATGCTCTCTGG + Intronic