ID: 1016433004

View in Genome Browser
Species Human (GRCh38)
Location 6:144007916-144007938
Sequence GATCTGCGGGGTCCCGCACC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 43}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016433000_1016433004 -6 Left 1016433000 6:144007899-144007921 CCTGGGTTGCGGGTGACGATCTG 0: 1
1: 0
2: 0
3: 3
4: 51
Right 1016433004 6:144007916-144007938 GATCTGCGGGGTCCCGCACCCGG 0: 1
1: 0
2: 0
3: 3
4: 43
1016432990_1016433004 27 Left 1016432990 6:144007866-144007888 CCAGGGGGTCCGGCGGCACTCGC 0: 1
1: 0
2: 0
3: 5
4: 52
Right 1016433004 6:144007916-144007938 GATCTGCGGGGTCCCGCACCCGG 0: 1
1: 0
2: 0
3: 3
4: 43
1016432995_1016433004 18 Left 1016432995 6:144007875-144007897 CCGGCGGCACTCGCGGTGGGGCT 0: 1
1: 0
2: 0
3: 9
4: 64
Right 1016433004 6:144007916-144007938 GATCTGCGGGGTCCCGCACCCGG 0: 1
1: 0
2: 0
3: 3
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016433004 Original CRISPR GATCTGCGGGGTCCCGCACC CGG Intronic
903925102 1:26826547-26826569 GACCTGCGGGGCCCCGCCGCGGG + Intergenic
905789404 1:40782474-40782496 GATCTGTGGGGTCCCTAAACTGG - Intergenic
907268056 1:53274793-53274815 AATCTGCGGGGACCCTCACAGGG + Intronic
920331352 1:205211003-205211025 GGTCCCCGGGGTCCCGCTCCGGG + Intronic
1074369635 10:112889548-112889570 GATCTGCAGGGCTCAGCACCAGG - Intergenic
1098222124 12:68281232-68281254 GCTGTGCGGGGTCCCCCTCCAGG - Intronic
1102440903 12:112963316-112963338 GATCAGCGGGGTCCAGGACCAGG - Exonic
1110317934 13:74132989-74133011 GCTCTGCGGGTTCCCGGCCCGGG + Intronic
1118388799 14:65279694-65279716 GGGCTGCCGGGTCCCGCGCCTGG - Intergenic
1120203802 14:81566727-81566749 GGTCTGCTGGGTCTTGCACCAGG + Intergenic
1122425527 14:101603193-101603215 GACCAGCGGGGTCTCACACCGGG + Intergenic
1133197788 16:4183569-4183591 GACCTGCGGGGTGAGGCACCGGG + Intergenic
1140136499 16:72210515-72210537 GATCTGAGGTGTCCCCCAGCAGG - Intergenic
1142379032 16:89721462-89721484 GGCCGGCGGGGTCCCGCCCCTGG + Intronic
1142952882 17:3497987-3498009 TATCTGAAGGGTCCCGCACCAGG - Intronic
1147165916 17:38593262-38593284 GAGCTGCTGGGGCCCCCACCTGG + Intronic
1157592009 18:48841756-48841778 TATCCCAGGGGTCCCGCACCTGG + Intronic
1159390738 18:67789039-67789061 GATCTGAGGGGTCCACCTCCTGG + Intergenic
1160509376 18:79444677-79444699 GGTCTGCGGGGTCGGGCACGTGG - Intronic
1163487887 19:17599825-17599847 GAGCTGCGGGATCCACCACCAGG - Intergenic
1166962622 19:46507935-46507957 GAGCCGCGGGGCCCCGCCCCAGG - Intronic
1168717586 19:58538495-58538517 GATCTGGGGGGCCGCGCGCCCGG + Intronic
937463618 2:122110449-122110471 GATCTGGGGGGGCCCGGACTGGG + Intergenic
938260464 2:129892080-129892102 TATCTGCTGGGTCCCTCATCGGG + Intergenic
942134097 2:172908334-172908356 GCTCTGCTGGGTCCCACACTGGG + Intronic
1171464555 20:25318489-25318511 GGTCTGCGGGATCCACCACCCGG - Intronic
1172149355 20:32779606-32779628 GATCTGGGGAGTCCCCCTCCTGG + Intronic
1172320762 20:33993817-33993839 GAGCTGCGGGGAGCCGCTCCGGG + Exonic
1176039513 20:63056804-63056826 GAGCTGAGGGGTCCAGCACGTGG + Intergenic
1178436657 21:32565848-32565870 GATCTGAGGACTCCCTCACCAGG + Intergenic
1185373685 22:50472313-50472335 GAGCTGCTGGGTGCAGCACCAGG - Intronic
959965369 3:112347772-112347794 GATCTGCCAGGTGCTGCACCTGG + Exonic
962372061 3:134828884-134828906 TATCTGCAGGGTCCCGTCCCTGG + Intronic
988383700 5:30533868-30533890 GATATGAGGGGACCCACACCTGG - Intergenic
994592334 5:101789040-101789062 GAGCAGCGGGGTCCTGGACCTGG - Intergenic
995031828 5:107490001-107490023 GATCTCCAGGGTCCCTCAGCTGG + Intronic
1016433004 6:144007916-144007938 GATCTGCGGGGTCCCGCACCCGG + Intronic
1018226478 6:161634256-161634278 CATCTGCGGGGACGCTCACCAGG - Intronic
1018872871 6:167796542-167796564 GAGCTGCGGGCTCCTCCACCCGG + Intronic
1029372460 7:100158317-100158339 GCGGTGCGGGGTCCGGCACCGGG - Exonic
1029544575 7:101203453-101203475 GATCTGCGGGCTCCAGCCCTGGG + Intergenic
1034498191 7:151434175-151434197 GAGCTCCTGGGTCCCCCACCTGG + Intronic
1049087048 8:140486942-140486964 TATCAGCGGGGTCTCCCACCGGG + Intergenic
1049523067 8:143104623-143104645 GATCTCCGGGGTCCAGCGCCTGG - Intergenic
1056382104 9:86064813-86064835 GATCTGCTGCATCCCCCACCAGG - Intronic
1062282853 9:135759679-135759701 GACCTGCGGCATCCAGCACCTGG + Exonic
1186350106 X:8731863-8731885 GATCTGCAGGCTCAGGCACCTGG + Exonic