ID: 1016435582

View in Genome Browser
Species Human (GRCh38)
Location 6:144034143-144034165
Sequence GTGGTTTTACATGTAAACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 175}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016435582_1016435588 -6 Left 1016435582 6:144034143-144034165 CCTGTGTTTACATGTAAAACCAC 0: 1
1: 0
2: 1
3: 9
4: 175
Right 1016435588 6:144034160-144034182 AACCACGTTGTTGGAGGAGGGGG No data
1016435582_1016435594 30 Left 1016435582 6:144034143-144034165 CCTGTGTTTACATGTAAAACCAC 0: 1
1: 0
2: 1
3: 9
4: 175
Right 1016435594 6:144034196-144034218 CGAACCCCAGCCTCCCTCCTGGG No data
1016435582_1016435587 -7 Left 1016435582 6:144034143-144034165 CCTGTGTTTACATGTAAAACCAC 0: 1
1: 0
2: 1
3: 9
4: 175
Right 1016435587 6:144034159-144034181 AAACCACGTTGTTGGAGGAGGGG No data
1016435582_1016435593 29 Left 1016435582 6:144034143-144034165 CCTGTGTTTACATGTAAAACCAC 0: 1
1: 0
2: 1
3: 9
4: 175
Right 1016435593 6:144034195-144034217 GCGAACCCCAGCCTCCCTCCTGG 0: 1
1: 0
2: 2
3: 30
4: 666
1016435582_1016435585 -9 Left 1016435582 6:144034143-144034165 CCTGTGTTTACATGTAAAACCAC 0: 1
1: 0
2: 1
3: 9
4: 175
Right 1016435585 6:144034157-144034179 TAAAACCACGTTGTTGGAGGAGG 0: 1
1: 0
2: 1
3: 6
4: 143
1016435582_1016435586 -8 Left 1016435582 6:144034143-144034165 CCTGTGTTTACATGTAAAACCAC 0: 1
1: 0
2: 1
3: 9
4: 175
Right 1016435586 6:144034158-144034180 AAAACCACGTTGTTGGAGGAGGG 0: 1
1: 0
2: 3
3: 17
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016435582 Original CRISPR GTGGTTTTACATGTAAACAC AGG (reversed) Intronic
902487082 1:16755788-16755810 GTACATTTACATGTAAGCACAGG - Intronic
902717528 1:18282838-18282860 GTAGTTTTAGATGTTAGCACAGG - Intronic
904288186 1:29467156-29467178 GTGGCATTCCATGTTAACACTGG + Intergenic
906026036 1:42674740-42674762 GAGGTTTTACATGAAAATATGGG + Intronic
909650205 1:77966446-77966468 GTGGCTTTACAAGTAGAGACTGG + Intronic
909883126 1:80905356-80905378 ATGGTTATACATGTAAGAACAGG - Intergenic
909940942 1:81611176-81611198 GTGGTTCTTCATATAAAGACCGG + Intronic
909988110 1:82187382-82187404 ATTGTGTTCCATGTAAACACAGG - Intergenic
912139589 1:106706758-106706780 GTGGTTGTACGTGTAAACACTGG - Intergenic
914734477 1:150402244-150402266 GGGGTTTTAAATGGAAACATTGG + Intronic
914807790 1:151004231-151004253 GTCATTTTAGATGTGAACACCGG + Intronic
916957217 1:169851107-169851129 TTGGTTTTAATTGTAAAAACAGG - Intronic
918727317 1:187942167-187942189 GGGGTTTTAGATGTAATCACAGG - Intergenic
920640661 1:207748850-207748872 GTGGCATTACATATCAACACAGG - Intergenic
922544385 1:226444999-226445021 TTTGTTTAACATGTATACACAGG + Intergenic
923707310 1:236354565-236354587 GTGGTTTTTCTTGTAGCCACAGG - Intronic
924858816 1:247900342-247900364 GTGGAAATAAATGTAAACACTGG - Intergenic
924946828 1:248852108-248852130 GTGGTTTTAGATGAAAAGAGTGG - Intronic
1063189544 10:3680461-3680483 GGGATTTAACATGTTAACACAGG - Intergenic
1063248858 10:4252287-4252309 GTGGTCTCACATGTAACTACAGG - Intergenic
1067005149 10:42653851-42653873 TTGGTTTAACATGTAAATAGGGG - Intergenic
1068223169 10:54069251-54069273 GTGGATTGACAGGTAAAGACAGG - Intronic
1069127425 10:64653699-64653721 GTGGTTTTACATTTCAATCCTGG - Intergenic
1071688551 10:87790108-87790130 GTATTTTAACATGTAAATACAGG + Intronic
1074046598 10:109844974-109844996 GTTTCTTTACCTGTAAACACAGG - Intergenic
1074261746 10:111860984-111861006 GTGCTTTGACATGTGCACACTGG - Intergenic
1074893255 10:117752743-117752765 ATGGTTTTACACCCAAACACAGG + Intergenic
1075965435 10:126607368-126607390 GTGGTGTTTCATGAAAACAGTGG - Intronic
1076133020 10:128026657-128026679 GTGATTTTACATTTAGACATAGG + Intronic
1076424757 10:130359605-130359627 GAGGTTTTTCATCTAAAAACAGG - Intergenic
1077164280 11:1128231-1128253 GCAGTTTTACCTGTACACACAGG - Intergenic
1077793156 11:5462787-5462809 GTGCTTGTACATTTGAACACAGG + Intronic
1078867118 11:15307981-15308003 GTGGGTTAACATGTAAATAAGGG + Intergenic
1081794732 11:45811491-45811513 CTGATATTACTTGTAAACACTGG - Exonic
1081794734 11:45811527-45811549 CTGGTATTACTTGTAAACACTGG - Exonic
1088383439 11:109222250-109222272 GTAGTTTTACATGGAAAAAATGG - Intergenic
1088576336 11:111275430-111275452 TTGGCTTTACATGTGAAGACTGG + Intronic
1089037317 11:115408190-115408212 TTATTTTTACATGTGAACACTGG + Intronic
1092011235 12:5114420-5114442 GTGGTTTGACATGTAGACTTTGG - Intergenic
1096970309 12:55660220-55660242 GTGGTTTTTACTGTAGACACAGG + Intergenic
1097448164 12:59701264-59701286 GTGGTTTCATCTGTAAAAACAGG - Intronic
1099473528 12:83079549-83079571 TTGCTTTTACTTGTAACCACGGG + Intronic
1100723779 12:97386950-97386972 ATGGTTTTAAATTTAAATACAGG - Intergenic
1106711332 13:32337134-32337156 ATGGTTTTATATGGAGACACAGG + Exonic
1108235737 13:48403133-48403155 GTGTTTTTACATCAAAACACAGG - Intronic
1109252793 13:60040475-60040497 GTGATTTTACCTAAAAACACTGG - Intronic
1112283303 13:98081601-98081623 GAGCTTCTACGTGTAAACACAGG + Intergenic
1113223648 13:108134593-108134615 GTGGGTTTTGATGTAAAAACAGG - Intergenic
1113242764 13:108357701-108357723 AAGGTTTTACATGGAACCACAGG - Intergenic
1115699497 14:35937022-35937044 GTGATCTTACATGAAAGCACAGG - Intergenic
1116030978 14:39571162-39571184 GTGGTTTTATATATATACAATGG - Intergenic
1118401954 14:65388070-65388092 GTGATTTTATAAGTAAGCACAGG + Intergenic
1121926966 14:97936096-97936118 GTAGTTTTAAAGGTAAAAACTGG - Intronic
1124399001 15:29332301-29332323 ATAGCTTTACATGTAAACACTGG + Intronic
1125457811 15:39878759-39878781 GTGGTTTTACAACTAAAGGCAGG - Intronic
1128600517 15:68991685-68991707 GTGGTTTAACATCCAAAAACTGG + Intronic
1130928491 15:88403013-88403035 GTGGGTGCACATGTACACACAGG - Intergenic
1131432913 15:92400982-92401004 GTGTTTTTATTTGAAAACACTGG + Intronic
1131895910 15:97029114-97029136 GTGATTTCACATTTAACCACAGG - Intergenic
1133542254 16:6767507-6767529 GAGGTTTTAAATTAAAACACTGG - Intronic
1134184915 16:12077099-12077121 GTTGTTTTATTTGTAAAGACAGG - Intronic
1138756794 16:59496397-59496419 ATGATTTTCCATGTAATCACAGG + Intergenic
1140200521 16:72891051-72891073 GTGGTTTTAAATACAAACACTGG - Intronic
1141759834 16:86020883-86020905 GTCGTTTTGCATGTAAAGCCAGG + Intergenic
1145200018 17:20936150-20936172 GTGGTTTAACATTTACAAACTGG + Intergenic
1149152567 17:53586176-53586198 GTGGTTTTACTTGGATACAGTGG - Intergenic
1149185232 17:53989769-53989791 GTTGTTATAAACGTAAACACAGG + Intergenic
1149456929 17:56795402-56795424 GTGGATTTCCATGAAAACATGGG + Intronic
1159746922 18:72247833-72247855 GTGGTTGGACATATAATCACAGG + Intergenic
1159911488 18:74150682-74150704 GTGGTATTACATGTGTACCCCGG + Intronic
1164951368 19:32339896-32339918 GTGGTATTACCTGTCAACAGGGG + Intergenic
1168170617 19:54586153-54586175 GAAGTTTTACATATATACACAGG + Intronic
1168632342 19:57967336-57967358 GTTTTTTAACATGTGAACACTGG + Intronic
1202704127 1_KI270713v1_random:8451-8473 GTACATTTACATGTAAGCACAGG + Intergenic
927299451 2:21494652-21494674 TTTGTTGTACATGTAAACAAAGG - Intergenic
928130430 2:28645121-28645143 GTGGTATTACATACATACACTGG + Intergenic
928160113 2:28915205-28915227 GTGGTTTTGAAGGTAAACAGAGG - Intronic
929780046 2:44951711-44951733 GTGGTTTTATTTGTAAAAAGTGG - Intergenic
931845468 2:66199476-66199498 GTGGTTTTACGTGGAAGCAGTGG - Intergenic
932543542 2:72682838-72682860 GTGGGGTTTCAGGTAAACACTGG + Intronic
933292482 2:80453151-80453173 GTGGATTTCCATTTCAACACTGG + Intronic
933318515 2:80743550-80743572 GAGGTTTTTCATGGAAACTCAGG - Intergenic
933999282 2:87693144-87693166 GTGGTTTTTCTTGTAACCATAGG + Intergenic
934888318 2:98044430-98044452 GTGGTTTTAAATGTAAGCAGGGG + Intergenic
936294569 2:111257747-111257769 GTGGTTTTTCTTGTAACCATAGG - Intergenic
937146730 2:119653082-119653104 GTGGTTTAAAATATAAATACCGG + Intronic
937487772 2:122333853-122333875 ATGATTTTACATGCAAACTCAGG - Intergenic
940625130 2:156165738-156165760 GTGCTTTTATTTTTAAACACGGG - Intergenic
941081292 2:161063730-161063752 ATGGCTTAACATGTAATCACTGG + Intergenic
1171367109 20:24632784-24632806 GTGGCTTTACAAGGAAACAAGGG + Intronic
1174440213 20:50545582-50545604 GTGGTTTTACGTGTACAGCCTGG + Intronic
1175717206 20:61263128-61263150 GAGGTTTTACAAGAACACACCGG - Intronic
1175816845 20:61887429-61887451 GTGGGTTTACATGCATACAGAGG + Intronic
1176875579 21:14123719-14123741 TTGGTTTCACATGTAAATAGGGG - Intronic
1177552924 21:22649230-22649252 GTGATCTTAGATATAAACACTGG + Intergenic
1178127725 21:29533622-29533644 GAGTTATTACTTGTAAACACAGG + Intronic
1179450616 21:41466096-41466118 GTCGTTTTACAAGAAAACAATGG - Exonic
1179670642 21:42944789-42944811 GTGGAAATAAATGTAAACACTGG - Intergenic
1182736307 22:32533963-32533985 GTGGATTCACATGGAAAAACAGG + Intronic
1182770493 22:32792356-32792378 TTGGTTTTACATTTAAAGAAAGG + Intronic
951248297 3:20365994-20366016 GTGGAAATAAATGTAAACACTGG - Intergenic
951515001 3:23549215-23549237 AAGGTTTTAAATGAAAACACTGG + Intronic
952900799 3:38110397-38110419 GTGTTTTTACAGGTAGACATGGG + Intronic
952929992 3:38352495-38352517 GTGTTTTTACATGGAAATATAGG - Intronic
957185283 3:76933961-76933983 GTGGTTCAACATGCAAATACTGG - Intronic
959488267 3:106954255-106954277 GTGGTTCTAAATGTAAATAGAGG - Intergenic
960497172 3:118388575-118388597 GTGGTTATAAATATACACACAGG + Intergenic
960607156 3:119518362-119518384 GAGGTTTCAAATGAAAACACTGG - Intronic
965732855 3:171791185-171791207 GTGGATTTGGATGTAACCACAGG - Intronic
972244751 4:37234028-37234050 GAGGCTTTAAATGTGAACACTGG - Intergenic
973694222 4:53474279-53474301 GTGTGTATACATATAAACACAGG + Intronic
973903470 4:55502023-55502045 GTTATTTTACGTGTAAAAACAGG - Intronic
974017946 4:56666127-56666149 GTGGTTTTAACTGAAATCACTGG - Intronic
974145783 4:57945698-57945720 GTGTTCTTACAGGGAAACACAGG - Intergenic
978260162 4:106746504-106746526 TTGGTTTTACATATACACCCAGG + Intergenic
978633154 4:110770825-110770847 GGGGTTTTGCATGTAAAATCAGG + Intergenic
978762592 4:112370481-112370503 TTGTTTTTACATTTAAACAATGG - Intronic
979354946 4:119692030-119692052 GTGGTTCTGTTTGTAAACACAGG + Intergenic
979759546 4:124384719-124384741 GTTGTTGTATATTTAAACACTGG + Intergenic
980150380 4:129039937-129039959 ATGCTTTTACATGTAAATTCAGG - Intronic
980692684 4:136316501-136316523 GTGGTTTATCATGTAAACAAGGG - Intergenic
981637893 4:146901281-146901303 GTGATTATAAATGTACACACTGG - Intronic
982186689 4:152809071-152809093 GTGTTGTAGCATGTAAACACAGG + Intronic
982457381 4:155626341-155626363 TTCGTTTTACATGAAATCACAGG - Intergenic
983489767 4:168374971-168374993 GTGGTTACAAATGTGAACACTGG - Intronic
983610905 4:169643902-169643924 GTTGTTTTACTTGAAAAGACAGG + Intronic
983898223 4:173104222-173104244 GTGGAAATAAATGTAAACACTGG + Intergenic
987136827 5:14907490-14907512 TTAGTATTACATGTAAATACAGG + Intergenic
987464020 5:18251191-18251213 AAAGTTTTACATGTAAACAGGGG + Intergenic
988053612 5:26062801-26062823 CTGGGTTAATATGTAAACACTGG - Intergenic
988854770 5:35217201-35217223 GTGGGTGTACATGCCAACACTGG + Intronic
990991581 5:61689608-61689630 GTGGATTTGCTTATAAACACAGG - Intronic
993188552 5:84651675-84651697 GTGATTTTAGAGGTAAACAAAGG + Intergenic
994309294 5:98248838-98248860 GTGTATTTACATATAAATACAGG + Intergenic
995681743 5:114728142-114728164 GTGGTTTTACAACTAAAGATTGG - Intergenic
996833843 5:127769451-127769473 GTGGTTGTACATTTGAAAACTGG + Intergenic
999598380 5:153232313-153232335 GTGATTTTTCATGAAAAAACTGG - Intergenic
1004286022 6:14321839-14321861 GTGGTTTGAAATGTGAGCACTGG - Intergenic
1006487457 6:34355332-34355354 CTGGTTTAACATTTAAAAACTGG - Intronic
1011842720 6:91521916-91521938 ATGGTTTTAAATGTATCCACAGG + Intergenic
1011871559 6:91900822-91900844 TTGGATTTACATGTTATCACTGG + Intergenic
1013172258 6:107647356-107647378 GTGGTTTTGCATGGAAACTCTGG - Intronic
1014211214 6:118710169-118710191 GTGGTTTTACACGGAAGCTCAGG - Intergenic
1014828814 6:126077279-126077301 TTAGTTTTACATGTAAAAATTGG - Intergenic
1016435582 6:144034143-144034165 GTGGTTTTACATGTAAACACAGG - Intronic
1017117423 6:150991600-150991622 GTAATTTGACATGTAGACACAGG + Intronic
1018894940 6:168007771-168007793 GTGGTTTTTCTTGTAGCCACAGG + Intronic
1019570550 7:1709632-1709654 GTGGTTTTACGCTCAAACACTGG - Intronic
1020043633 7:5023196-5023218 GTGGAAATAAATGTAAACACTGG - Intronic
1022904944 7:34846813-34846835 TTTGTTTTACACATAAACACAGG - Intronic
1023240130 7:38135426-38135448 GTGGTTTTAAATGTATGCAAAGG + Intergenic
1024542235 7:50486091-50486113 TTGGTTTTCACTGTAAACACTGG - Intronic
1026423447 7:70265130-70265152 GTGTTTGTAGATATAAACACTGG - Intronic
1027758496 7:82247611-82247633 GTGCTTTATCATGAAAACACAGG + Intronic
1027774915 7:82452589-82452611 GTGTTTCTACATTTAATCACTGG + Intergenic
1027780736 7:82516735-82516757 GTGGTATGACATGAACACACTGG - Intergenic
1027997486 7:85443591-85443613 GTTGAGTTACATATAAACACAGG + Intergenic
1029027168 7:97429050-97429072 ATGGTTTAACATACAAACACAGG + Intergenic
1029866702 7:103639181-103639203 GTAGTTTTACTAGAAAACACAGG + Intronic
1031300031 7:120053888-120053910 GTGGTTGAACATGTAAATAGGGG + Intergenic
1031690207 7:124778555-124778577 GTGGTTTTACATCTAGACTGTGG + Intronic
1041602650 8:59738435-59738457 GTGATTTTACATGTCAAAAATGG - Intergenic
1042230437 8:66548967-66548989 ATGGTTTTAAATGACAACACAGG - Intergenic
1043698525 8:83252193-83252215 TTGGTTTTACATATAAAAATAGG - Intergenic
1044136498 8:88592352-88592374 GAGCTTTTATATGTAAATACTGG - Intergenic
1046200274 8:110918184-110918206 TCTGTTTTACATGCAAACACTGG + Intergenic
1047073050 8:121369188-121369210 GTGGTTCTAAATGTATACAAAGG - Intergenic
1050043903 9:1523792-1523814 GTACTTTAACATGTAAACTCAGG - Intergenic
1051669717 9:19497245-19497267 GGTGTTTTACATGTTAACAAGGG - Intergenic
1051731287 9:20145711-20145733 GTGCTTTTATATGTTAACAGTGG - Intergenic
1051855012 9:21555039-21555061 GTGGTTTTTGAAGTAAAAACTGG - Intergenic
1055004471 9:71489518-71489540 TTTGTATCACATGTAAACACTGG - Intergenic
1055661599 9:78509188-78509210 GTGGGATTACATGTAAGAACAGG + Intergenic
1056236443 9:84599303-84599325 GAAGTTTTAAATGGAAACACAGG - Intergenic
1056254120 9:84780797-84780819 ATGGTTATACATGGAAACATAGG + Intronic
1056368193 9:85927745-85927767 GTGGTTTTACATTTTATCTCAGG + Intergenic
1056374919 9:85998226-85998248 ATAGTTTTACATGTAAAAATGGG + Intronic
1057769353 9:97953624-97953646 GTGGATTGACTTGTAAACAAAGG - Intergenic
1191755159 X:64584914-64584936 GTGTTCTTACATGAAAACACAGG - Intergenic
1193430121 X:81391817-81391839 GTGGTGTTAAATGTACTCACTGG - Intergenic
1193744576 X:85260504-85260526 GTGGTTTTTCATATATTCACAGG + Intronic
1195608125 X:106833082-106833104 TTGGTTTTACAGGTCAACTCTGG + Intronic
1197173942 X:123464894-123464916 GTGGTCTTACATGAAATCAGCGG + Exonic
1200706496 Y:6447306-6447328 GTGGTTCTACAAGCAAACGCAGG + Intergenic
1200880431 Y:8206773-8206795 CTTGTTTTCCATGTAAACAAGGG - Intergenic
1201027616 Y:9717402-9717424 GTGGTTCTACAAGCAAACGCAGG - Intergenic