ID: 1016435761

View in Genome Browser
Species Human (GRCh38)
Location 6:144035513-144035535
Sequence GTGCCCAACCAGACTGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016435757_1016435761 0 Left 1016435757 6:144035490-144035512 CCGTGCTGGCAGCTGATTAGATG 0: 252
1: 472
2: 594
3: 535
4: 521
Right 1016435761 6:144035513-144035535 GTGCCCAACCAGACTGAGGGTGG No data
1016435752_1016435761 29 Left 1016435752 6:144035461-144035483 CCCATCTTCTCCTGCCTGCTTTA 0: 2
1: 5
2: 31
3: 110
4: 459
Right 1016435761 6:144035513-144035535 GTGCCCAACCAGACTGAGGGTGG No data
1016435755_1016435761 15 Left 1016435755 6:144035475-144035497 CCTGCTTTATTCTAGCCGTGCTG 0: 11
1: 157
2: 233
3: 330
4: 335
Right 1016435761 6:144035513-144035535 GTGCCCAACCAGACTGAGGGTGG No data
1016435753_1016435761 28 Left 1016435753 6:144035462-144035484 CCATCTTCTCCTGCCTGCTTTAT 0: 53
1: 85
2: 167
3: 406
4: 1118
Right 1016435761 6:144035513-144035535 GTGCCCAACCAGACTGAGGGTGG No data
1016435754_1016435761 19 Left 1016435754 6:144035471-144035493 CCTGCCTGCTTTATTCTAGCCGT 0: 3
1: 28
2: 77
3: 64
4: 113
Right 1016435761 6:144035513-144035535 GTGCCCAACCAGACTGAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016435761 Original CRISPR GTGCCCAACCAGACTGAGGG TGG Intronic
No off target data available for this crispr