ID: 1016442483

View in Genome Browser
Species Human (GRCh38)
Location 6:144098021-144098043
Sequence AAACCCTCATTCACATAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016442481_1016442483 20 Left 1016442481 6:144097978-144098000 CCAGTCTACTCTGTAATCTCGTT No data
Right 1016442483 6:144098021-144098043 AAACCCTCATTCACATAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016442483 Original CRISPR AAACCCTCATTCACATAGAT AGG Intergenic