ID: 1016450676

View in Genome Browser
Species Human (GRCh38)
Location 6:144179268-144179290
Sequence TAATTCCCACACGTTGTGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8230
Summary {0: 1, 1: 21, 2: 828, 3: 2721, 4: 4659}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016450676_1016450682 9 Left 1016450676 6:144179268-144179290 CCTCGCACAACGTGTGGGAATTA 0: 1
1: 21
2: 828
3: 2721
4: 4659
Right 1016450682 6:144179300-144179322 CATTCAAGATGAGATTTGGGTGG 0: 104
1: 7793
2: 11440
3: 10277
4: 8638
1016450676_1016450680 6 Left 1016450676 6:144179268-144179290 CCTCGCACAACGTGTGGGAATTA 0: 1
1: 21
2: 828
3: 2721
4: 4659
Right 1016450680 6:144179297-144179319 TACCATTCAAGATGAGATTTGGG 0: 77
1: 7035
2: 10594
3: 9589
4: 8172
1016450676_1016450679 5 Left 1016450676 6:144179268-144179290 CCTCGCACAACGTGTGGGAATTA 0: 1
1: 21
2: 828
3: 2721
4: 4659
Right 1016450679 6:144179296-144179318 GTACCATTCAAGATGAGATTTGG 0: 6
1: 623
2: 7220
3: 10708
4: 10433
1016450676_1016450683 10 Left 1016450676 6:144179268-144179290 CCTCGCACAACGTGTGGGAATTA 0: 1
1: 21
2: 828
3: 2721
4: 4659
Right 1016450683 6:144179301-144179323 ATTCAAGATGAGATTTGGGTGGG 0: 7461
1: 10942
2: 10318
3: 7687
4: 6503
1016450676_1016450684 11 Left 1016450676 6:144179268-144179290 CCTCGCACAACGTGTGGGAATTA 0: 1
1: 21
2: 828
3: 2721
4: 4659
Right 1016450684 6:144179302-144179324 TTCAAGATGAGATTTGGGTGGGG 0: 7463
1: 11190
2: 9643
3: 7118
4: 4722

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016450676 Original CRISPR TAATTCCCACACGTTGTGCG AGG (reversed) Intronic
Too many off-targets to display for this crispr