ID: 1016451966

View in Genome Browser
Species Human (GRCh38)
Location 6:144192593-144192615
Sequence GGAGCAGGGGATGGGGACGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016451966_1016451975 7 Left 1016451966 6:144192593-144192615 CCATCGTCCCCATCCCCTGCTCC No data
Right 1016451975 6:144192623-144192645 TATCTTAACTTGCAAATGGCAGG No data
1016451966_1016451974 3 Left 1016451966 6:144192593-144192615 CCATCGTCCCCATCCCCTGCTCC No data
Right 1016451974 6:144192619-144192641 TGTCTATCTTAACTTGCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016451966 Original CRISPR GGAGCAGGGGATGGGGACGA TGG (reversed) Intergenic
No off target data available for this crispr