ID: 1016451968

View in Genome Browser
Species Human (GRCh38)
Location 6:144192601-144192623
Sequence AGACAGAAGGAGCAGGGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016451968_1016451976 24 Left 1016451968 6:144192601-144192623 CCCATCCCCTGCTCCTTCTGTCT No data
Right 1016451976 6:144192648-144192670 CAATCAACTGCCACCTGCCCAGG No data
1016451968_1016451975 -1 Left 1016451968 6:144192601-144192623 CCCATCCCCTGCTCCTTCTGTCT No data
Right 1016451975 6:144192623-144192645 TATCTTAACTTGCAAATGGCAGG No data
1016451968_1016451974 -5 Left 1016451968 6:144192601-144192623 CCCATCCCCTGCTCCTTCTGTCT No data
Right 1016451974 6:144192619-144192641 TGTCTATCTTAACTTGCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016451968 Original CRISPR AGACAGAAGGAGCAGGGGAT GGG (reversed) Intergenic
No off target data available for this crispr