ID: 1016451972

View in Genome Browser
Species Human (GRCh38)
Location 6:144192608-144192630
Sequence TTAAGATAGACAGAAGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016451972_1016451975 -8 Left 1016451972 6:144192608-144192630 CCTGCTCCTTCTGTCTATCTTAA No data
Right 1016451975 6:144192623-144192645 TATCTTAACTTGCAAATGGCAGG No data
1016451972_1016451976 17 Left 1016451972 6:144192608-144192630 CCTGCTCCTTCTGTCTATCTTAA No data
Right 1016451976 6:144192648-144192670 CAATCAACTGCCACCTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016451972 Original CRISPR TTAAGATAGACAGAAGGAGC AGG (reversed) Intergenic
No off target data available for this crispr