ID: 1016451975

View in Genome Browser
Species Human (GRCh38)
Location 6:144192623-144192645
Sequence TATCTTAACTTGCAAATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016451967_1016451975 0 Left 1016451967 6:144192600-144192622 CCCCATCCCCTGCTCCTTCTGTC No data
Right 1016451975 6:144192623-144192645 TATCTTAACTTGCAAATGGCAGG No data
1016451972_1016451975 -8 Left 1016451972 6:144192608-144192630 CCTGCTCCTTCTGTCTATCTTAA No data
Right 1016451975 6:144192623-144192645 TATCTTAACTTGCAAATGGCAGG No data
1016451966_1016451975 7 Left 1016451966 6:144192593-144192615 CCATCGTCCCCATCCCCTGCTCC No data
Right 1016451975 6:144192623-144192645 TATCTTAACTTGCAAATGGCAGG No data
1016451968_1016451975 -1 Left 1016451968 6:144192601-144192623 CCCATCCCCTGCTCCTTCTGTCT No data
Right 1016451975 6:144192623-144192645 TATCTTAACTTGCAAATGGCAGG No data
1016451971_1016451975 -7 Left 1016451971 6:144192607-144192629 CCCTGCTCCTTCTGTCTATCTTA No data
Right 1016451975 6:144192623-144192645 TATCTTAACTTGCAAATGGCAGG No data
1016451970_1016451975 -6 Left 1016451970 6:144192606-144192628 CCCCTGCTCCTTCTGTCTATCTT No data
Right 1016451975 6:144192623-144192645 TATCTTAACTTGCAAATGGCAGG No data
1016451969_1016451975 -2 Left 1016451969 6:144192602-144192624 CCATCCCCTGCTCCTTCTGTCTA No data
Right 1016451975 6:144192623-144192645 TATCTTAACTTGCAAATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016451975 Original CRISPR TATCTTAACTTGCAAATGGC AGG Intergenic
No off target data available for this crispr