ID: 1016457169

View in Genome Browser
Species Human (GRCh38)
Location 6:144243429-144243451
Sequence ACTTTTCCAGCCGGGTGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016457169_1016457172 3 Left 1016457169 6:144243429-144243451 CCACAGCACCCGGCTGGAAAAGT No data
Right 1016457172 6:144243455-144243477 TATTTCTCCTTCATGTTTGAAGG 0: 247
1: 467
2: 698
3: 1110
4: 1532

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016457169 Original CRISPR ACTTTTCCAGCCGGGTGCTG TGG (reversed) Intergenic
No off target data available for this crispr