ID: 1016457172

View in Genome Browser
Species Human (GRCh38)
Location 6:144243455-144243477
Sequence TATTTCTCCTTCATGTTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4054
Summary {0: 247, 1: 467, 2: 698, 3: 1110, 4: 1532}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016457170_1016457172 -5 Left 1016457170 6:144243437-144243459 CCCGGCTGGAAAAGTCTTTATTT No data
Right 1016457172 6:144243455-144243477 TATTTCTCCTTCATGTTTGAAGG 0: 247
1: 467
2: 698
3: 1110
4: 1532
1016457171_1016457172 -6 Left 1016457171 6:144243438-144243460 CCGGCTGGAAAAGTCTTTATTTC No data
Right 1016457172 6:144243455-144243477 TATTTCTCCTTCATGTTTGAAGG 0: 247
1: 467
2: 698
3: 1110
4: 1532
1016457166_1016457172 30 Left 1016457166 6:144243402-144243424 CCAAAGTGCTGAGATTACAGGCG 0: 5703
1: 139709
2: 280893
3: 218782
4: 152310
Right 1016457172 6:144243455-144243477 TATTTCTCCTTCATGTTTGAAGG 0: 247
1: 467
2: 698
3: 1110
4: 1532
1016457169_1016457172 3 Left 1016457169 6:144243429-144243451 CCACAGCACCCGGCTGGAAAAGT No data
Right 1016457172 6:144243455-144243477 TATTTCTCCTTCATGTTTGAAGG 0: 247
1: 467
2: 698
3: 1110
4: 1532

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016457172 Original CRISPR TATTTCTCCTTCATGTTTGA AGG Intergenic
Too many off-targets to display for this crispr