ID: 1016457172

View in Genome Browser
Species Human (GRCh38)
Location 6:144243455-144243477
Sequence TATTTCTCCTTCATGTTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016457169_1016457172 3 Left 1016457169 6:144243429-144243451 CCACAGCACCCGGCTGGAAAAGT No data
Right 1016457172 6:144243455-144243477 TATTTCTCCTTCATGTTTGAAGG No data
1016457170_1016457172 -5 Left 1016457170 6:144243437-144243459 CCCGGCTGGAAAAGTCTTTATTT No data
Right 1016457172 6:144243455-144243477 TATTTCTCCTTCATGTTTGAAGG No data
1016457166_1016457172 30 Left 1016457166 6:144243402-144243424 CCAAAGTGCTGAGATTACAGGCG No data
Right 1016457172 6:144243455-144243477 TATTTCTCCTTCATGTTTGAAGG No data
1016457171_1016457172 -6 Left 1016457171 6:144243438-144243460 CCGGCTGGAAAAGTCTTTATTTC No data
Right 1016457172 6:144243455-144243477 TATTTCTCCTTCATGTTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016457172 Original CRISPR TATTTCTCCTTCATGTTTGA AGG Intergenic