ID: 1016458404

View in Genome Browser
Species Human (GRCh38)
Location 6:144256439-144256461
Sequence ATTAACCTGATTCCAAAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016458404_1016458406 4 Left 1016458404 6:144256439-144256461 CCAGTCTTTGGAATCAGGTTAAT No data
Right 1016458406 6:144256466-144256488 TTGGCCTCATAAAATGAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016458404 Original CRISPR ATTAACCTGATTCCAAAGAC TGG (reversed) Intergenic
No off target data available for this crispr