ID: 1016461226

View in Genome Browser
Species Human (GRCh38)
Location 6:144282304-144282326
Sequence TTGGGTTACCAGTAGACCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016461218_1016461226 29 Left 1016461218 6:144282252-144282274 CCATTTTCCTTAATTTTCACAGT No data
Right 1016461226 6:144282304-144282326 TTGGGTTACCAGTAGACCCAGGG No data
1016461219_1016461226 22 Left 1016461219 6:144282259-144282281 CCTTAATTTTCACAGTTCTGTGG No data
Right 1016461226 6:144282304-144282326 TTGGGTTACCAGTAGACCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016461226 Original CRISPR TTGGGTTACCAGTAGACCCA GGG Intergenic
No off target data available for this crispr