ID: 1016465648

View in Genome Browser
Species Human (GRCh38)
Location 6:144322453-144322475
Sequence TGCTCCACAAAGTCCCCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 4, 3: 15, 4: 176}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016465648 Original CRISPR TGCTCCACAAAGTCCCCTGC AGG (reversed) Intronic
900488230 1:2933570-2933592 TGCTCCCCGCAGACCCCTGCAGG + Intergenic
901062024 1:6475961-6475983 TCCTCCTCCAAGTCCACTGCGGG + Exonic
901323754 1:8355294-8355316 GGTTCCACAATGTCCCCTCCAGG + Intronic
902386532 1:16079115-16079137 TGACCCAGAAAGTACCCTGCTGG + Intergenic
903262514 1:22139065-22139087 TGCTCAACAAGGGCCCCCGCAGG - Intronic
904953216 1:34261184-34261206 TGGTCCCCCAAGTCCTCTGCAGG - Intergenic
906717999 1:47984538-47984560 TGCTGCATAAAGCCGCCTGCTGG - Intronic
911003186 1:93189485-93189507 TGATCCAGAAATTCCACTGCTGG - Intronic
915895488 1:159808453-159808475 TGCCCCACAAACTCCCAAGCTGG - Intronic
915920791 1:159973767-159973789 TGCCCCACAAACTCCCAAGCTGG + Intergenic
918339017 1:183551994-183552016 TGGCCCACACAGTCCCCTGCAGG + Intronic
922613060 1:226944155-226944177 TGCCCCACAGTGTTCCCTGCTGG - Intronic
922698675 1:227745286-227745308 AGCCCCACAGAGGCCCCTGCAGG + Intronic
923132806 1:231092115-231092137 TGCTCGTCAGCGTCCCCTGCTGG + Intergenic
1064684283 10:17843806-17843828 TGCTCCACAAAGTCTGGAGCAGG - Intronic
1065380982 10:25089634-25089656 TGATCCAGCAATTCCCCTGCTGG - Intergenic
1065422159 10:25557115-25557137 TGCACCACAAAGACCCATGCTGG + Intronic
1068724976 10:60290724-60290746 TGTGCCAGAAAGGCCCCTGCTGG + Intronic
1069521225 10:69123591-69123613 TGCTTCCCAAAGTCCCCAGATGG - Intronic
1070786936 10:79167428-79167450 TGCTCTGCAAACTCACCTGCAGG - Intronic
1071417898 10:85458339-85458361 TTCTCCACAGAGTGCCCTGAGGG + Intergenic
1071937755 10:90549785-90549807 TGCACAACAAAGTGCACTGCTGG - Intergenic
1074484179 10:113856144-113856166 TGCTTCACAAACATCCCTGCCGG - Intronic
1075789286 10:125071926-125071948 TCTTCCACCAAGTACCCTGCGGG - Intronic
1075871146 10:125773557-125773579 TGCTCCTCAAAGTCCCACTCGGG - Intronic
1076026375 10:127118043-127118065 TCCTGCACAAACTCCCCTCCTGG - Intronic
1076440062 10:130475450-130475472 GCCTCCACCAAGTCCCCTGCTGG + Intergenic
1077054046 11:581591-581613 AGCTCACCAAAGTCACCTGCCGG - Exonic
1077269408 11:1668176-1668198 TGCTCCAGGAAGGCGCCTGCGGG - Intergenic
1077284077 11:1758202-1758224 TGCTCCTAACAGTTCCCTGCTGG - Intronic
1081590844 11:44422051-44422073 TGTTCCACAAATTCCTCTGCAGG + Intergenic
1082702437 11:56449452-56449474 TGCTCCACAGACTCCTCTGTGGG - Intergenic
1082703966 11:56469695-56469717 TGCTCCACAGACTCCTCTGTGGG + Exonic
1083147011 11:60767475-60767497 TGTTCCACACCGCCCCCTGCCGG - Intronic
1084178354 11:67434857-67434879 GGCTCCACAAACTCCCATCCAGG - Intronic
1084268974 11:68019163-68019185 AGCACCACACAGTTCCCTGCAGG - Exonic
1085417596 11:76329759-76329781 TTCTCCATGAAGTCCCCAGCAGG + Intergenic
1087281114 11:96211694-96211716 TGCTCCACTAGGTACCCTGTGGG - Intronic
1088428384 11:109729994-109730016 TGCTGCACACACTCACCTGCAGG + Intergenic
1088842771 11:113640569-113640591 TGCTCCACACAGCCCTCTGTGGG - Intergenic
1090360940 11:126172167-126172189 TGGTCCGCAGAGTCCCCTCCAGG + Intergenic
1090843059 11:130509242-130509264 GGCACCACCAAGACCCCTGCAGG - Intergenic
1091693722 12:2613995-2614017 TGATTCAGAAAGTCCACTGCAGG - Intronic
1093140655 12:15506966-15506988 TGCTCCAGGAAGTCTCATGCAGG + Intronic
1094107938 12:26833218-26833240 TGGTCCAAAAATTCCCCTGAGGG - Intergenic
1096571277 12:52524658-52524680 TGCTCCCCACAGCCCCCTGCAGG - Intergenic
1097332369 12:58345360-58345382 TGCTCTCCCAAGTCCTCTGCTGG + Intergenic
1099973944 12:89526439-89526461 TTTTCCACACAGTGCCCTGCAGG + Intergenic
1101789225 12:107912499-107912521 TGCTCCACAGCGCCCCCTGCAGG - Intergenic
1104111799 12:125711267-125711289 GGATCCACACACTCCCCTGCTGG - Intergenic
1105865145 13:24452326-24452348 AGCTTGCCAAAGTCCCCTGCAGG + Intronic
1106352792 13:28949969-28949991 TGATCCAGAAATTCCCCTTCTGG - Intronic
1107129926 13:36884331-36884353 TCCCCCACAAAGCCTCCTGCTGG + Intronic
1108442530 13:50470253-50470275 TGCTACACAAAGTCCAATGCAGG + Intronic
1108482731 13:50891098-50891120 TGATCCACAAACTCCACTGAAGG - Intergenic
1112384611 13:98927485-98927507 TGTACCACCAAGTCTCCTGCAGG + Intronic
1119525297 14:75317918-75317940 TACTGCATAAAGGCCCCTGCTGG - Intergenic
1119525478 14:75319272-75319294 TACTGCATAAAGACCCCTGCTGG - Intergenic
1124700895 15:31910881-31910903 TGCTCCAACAAGTCTCCTTCAGG - Intergenic
1126439841 15:48675634-48675656 TGCTCCTCAAAGTCTCCAGAGGG + Intergenic
1127534945 15:59881497-59881519 TGCTACTCAAATTCCCCTTCAGG + Intergenic
1129769216 15:78192987-78193009 TGCTCCAGAAAAGCCCCCGCTGG + Intronic
1130566792 15:85003120-85003142 TGATCCACAAATTCCACTTCTGG - Intronic
1133006447 16:2884079-2884101 TGCTCCACGCAGTCCACAGCGGG - Intronic
1133812377 16:9170556-9170578 TGCTGCACAGACTCCCCTGCAGG + Intergenic
1135816176 16:25636029-25636051 TGCTCCCCAGAGTCACCTGGTGG - Intergenic
1138396785 16:56710501-56710523 TGCTGCACACAGTGCCCTGGAGG - Intronic
1139336632 16:66236467-66236489 TGCTGCTCCAAGTCCCCTGCAGG - Intergenic
1139489458 16:67278856-67278878 TTCTCCACAAAGTCCGGTGCAGG - Exonic
1139517655 16:67461251-67461273 TGCTGCACAAGGTCCCCTGCAGG - Intronic
1139798533 16:69502527-69502549 TTCTCCTCAAATTCCCCAGCAGG + Intergenic
1139914732 16:70421039-70421061 TGCTTCCCAAAGCCACCTGCAGG - Intronic
1143086727 17:4421584-4421606 TGCCCTAGAAATTCCCCTGCTGG - Intergenic
1143248554 17:5505315-5505337 TGCTCCACTCAATCCCCTGCTGG + Intronic
1147141185 17:38461426-38461448 TGCTCCCCAGAGGCCCCTGGTGG + Intronic
1147211799 17:38876123-38876145 GGTTCCACAAAGACCCCTCCAGG + Intronic
1150573007 17:66404698-66404720 TGTTCCACACACTCCCATGCTGG + Intronic
1150575928 17:66430759-66430781 TGCCCCAGAAAGTCTCCTGAAGG - Intronic
1150602024 17:66659390-66659412 TGCTCCACAGAGTCTCCTCATGG - Intronic
1150602976 17:66666508-66666530 AGCTTCTCAAAGTCCCCTGAAGG - Intronic
1151386074 17:73756194-73756216 AGCTCCACAAAGTCAGCTGTAGG - Intergenic
1151825747 17:76523267-76523289 AGCCCCACAGCGTCCCCTGCTGG - Intergenic
1152695210 17:81740820-81740842 TTCTCCACCAACTTCCCTGCTGG - Intergenic
1153443678 18:5149182-5149204 TGTCCCACAACCTCCCCTGCAGG - Intronic
1155067718 18:22282314-22282336 CACTCCACACACTCCCCTGCTGG - Intergenic
1155161691 18:23201425-23201447 CCTTCCACAAAGTCCACTGCTGG - Intronic
1155910160 18:31497576-31497598 TGCTCCACAACCTCCGCTCCAGG + Intergenic
1156638517 18:39061297-39061319 TGAGCAACAAAGTCACCTGCTGG + Intergenic
1156918697 18:42492210-42492232 TGCTCCACACAGTCCCATGCAGG + Intergenic
1161901483 19:7122837-7122859 TGCTCCACCGAGTACCCCGCTGG + Intronic
1163529066 19:17839092-17839114 TGCTCATTAAAGCCCCCTGCAGG - Intronic
1163639110 19:18451493-18451515 TGCAGCACAGAGTGCCCTGCAGG + Intronic
1163749731 19:19069240-19069262 GGCTCAACAAAGTTCTCTGCTGG + Intronic
1165269645 19:34694837-34694859 TGATCCAGCAATTCCCCTGCTGG + Intergenic
1165373158 19:35422811-35422833 TGATCCAGAAATCCCCCTGCTGG - Intergenic
1167073083 19:47231555-47231577 GGGTCCACAAAGTCACGTGCAGG + Intronic
926053800 2:9761913-9761935 TGCTCCCCAAAACCCCCAGCTGG + Intergenic
927271672 2:21216859-21216881 TGATCCAGAAATTCCACTGCGGG + Intergenic
927784601 2:25964979-25965001 TGCTTCACAATCTCTCCTGCGGG + Intronic
932434008 2:71692440-71692462 GGCTCCACAAAGTCCCCCCAGGG - Intergenic
933099046 2:78227168-78227190 TGATCCACAAATCCCACTGCTGG + Intergenic
933332714 2:80914712-80914734 TGATCCAGGAAGTCCACTGCTGG - Intergenic
936944001 2:117914284-117914306 TGTTCCTCAAACTCACCTGCTGG + Intergenic
940036116 2:149313627-149313649 TACTCCACAATGTCCCCTAGGGG - Intergenic
942007733 2:171723502-171723524 TCTTCCATAAAGTCACCTGCAGG - Intronic
942014085 2:171793514-171793536 TGCTCCACAGACTACCCTGCTGG + Intronic
942127413 2:172841099-172841121 GGCTCCACAAAGTCTCATGTTGG + Intronic
943037642 2:182766741-182766763 TCCTCAACAAACTTCCCTGCTGG - Intronic
943079768 2:183244661-183244683 TGCTCCACTGAGCCTCCTGCTGG - Intergenic
946587688 2:221208707-221208729 TGATCCACAAACACCCCTACTGG + Intergenic
948387020 2:237586876-237586898 TGCTTTACACAGTACCCTGCAGG - Intronic
948553774 2:238793452-238793474 TGATCCAGCAATTCCCCTGCTGG - Intergenic
1170375368 20:15694229-15694251 TGATCCAGAAATTCCACTGCTGG - Intronic
1171147235 20:22795542-22795564 TCCTCCTCACAGTCCCCTTCTGG - Intergenic
1173225524 20:41160307-41160329 TTCTGCACAAAGTCCTCTGGTGG + Intronic
1174526144 20:51173057-51173079 TGCTCCACAAAGTCTCCAGGTGG + Intergenic
1174956727 20:55106078-55106100 TGCTCCACCAAGGACACTGCTGG - Intergenic
1175004352 20:55666405-55666427 TTCTCCCCACAGTCCCCAGCAGG - Intergenic
1176093541 20:63329399-63329421 TGCTCCACACAGGCGCCTCCTGG - Intronic
1176196229 20:63837336-63837358 TGCTCCACTATGTCCCATCCTGG - Intergenic
1176859217 21:13996439-13996461 TGATCCAGAAAGTCCACTTCTGG - Intergenic
1179325038 21:40334129-40334151 TAGTGCACAAAGTCCCCTGAGGG + Intronic
1179471023 21:41610552-41610574 TGTACCACACTGTCCCCTGCTGG - Intergenic
1179605785 21:42514301-42514323 CGCTCCACGGAGTCCCCGGCAGG + Exonic
1179910451 21:44444627-44444649 TGCTCCACACTGCCCCCAGCGGG - Intergenic
1182332501 22:29561098-29561120 TGCCCCACCAAGGCCCCTGGTGG - Intronic
1182537931 22:31019862-31019884 TGCTACAGAAAGTCCCCACCAGG - Intergenic
1183343335 22:37294119-37294141 TGCTCCAGAAAGACACCAGCCGG + Intronic
955314979 3:57930737-57930759 TGCTCCAAAAAGTTCACTTCTGG + Intergenic
955401801 3:58597213-58597235 TGATCCCCCAAGTCCACTGCTGG - Intronic
960107364 3:113812939-113812961 TGTTCCCCAAACTCCCCAGCAGG - Intergenic
960339026 3:116452804-116452826 TTCTCCACAAAGCCCCTTACTGG - Intronic
960982684 3:123245993-123246015 TGCTATAGAAAGTCTCCTGCAGG + Exonic
961171393 3:124800204-124800226 TGCTCCACAGAGGCATCTGCGGG + Intronic
961649616 3:128410875-128410897 TGCTCCTCAAAGTCCCGGGAAGG + Intergenic
964434720 3:156639560-156639582 TGCTGCTCAAAATCCCCTGATGG + Intergenic
965956259 3:174373779-174373801 TGATCCAGAAAATCCACTGCTGG + Intergenic
967905007 3:194492078-194492100 GGGTCCACAAAGTCCAGTGCAGG + Intronic
968665935 4:1822417-1822439 TGCTGCCCAATGTCACCTGCAGG - Intronic
969007723 4:4034799-4034821 TGCTCGACGACGTCCCCTGTAGG - Intergenic
969158833 4:5237312-5237334 TGCACCCAACAGTCCCCTGCAGG - Intronic
972962211 4:44467500-44467522 TGCTCCAGCAATTCCACTGCTGG + Intergenic
978761634 4:112359652-112359674 TCCTCCCCCAAGGCCCCTGCTGG - Intronic
978869360 4:113556690-113556712 GGCTCCCCAAAGACCCCTGAAGG + Intronic
983468911 4:168132103-168132125 TGATCCAGAAAATCCACTGCTGG + Intronic
987119742 5:14755812-14755834 AGCTCCTCAGAGTCCCCTTCTGG - Intronic
988734012 5:34002670-34002692 TGATCCACACAGTTCCCTGAGGG - Intronic
995800844 5:115992529-115992551 TGCTCCACAAAGTCCTCTTCAGG + Intronic
996137947 5:119868487-119868509 TACTCCAGAAACTCCCCTTCTGG + Intergenic
999202644 5:149826976-149826998 TGATGCACGGAGTCCCCTGCGGG - Intronic
1001274005 5:170337119-170337141 TGCTCCTCAACAACCCCTGCTGG - Intergenic
1004560711 6:16747318-16747340 TGCTCCAGAAACTCCACTGTAGG - Intronic
1006869742 6:37240596-37240618 CTCTCCCCATAGTCCCCTGCAGG - Intronic
1007095164 6:39208434-39208456 TTCTTCTCAAAGCCCCCTGCAGG + Intronic
1007664401 6:43505845-43505867 TGCTCAACTAGGGCCCCTGCTGG + Exonic
1008387548 6:50910341-50910363 TTCTACAAAAAATCCCCTGCTGG + Intergenic
1010656482 6:78517763-78517785 TGCTCCACAAAGCACCCATCAGG + Intergenic
1014355397 6:120402561-120402583 TGATCCAACAATTCCCCTGCTGG - Intergenic
1016356790 6:143227310-143227332 TACTCCACACAGGACCCTGCTGG - Intronic
1016465648 6:144322453-144322475 TGCTCCACAAAGTCCCCTGCAGG - Intronic
1019152918 6:170020868-170020890 TTCTCCCCAAAGTGCCCTGTAGG + Intergenic
1019219316 6:170462119-170462141 TCCTCCAGAAAGTCCCAGGCTGG + Intergenic
1020328245 7:6992930-6992952 TGCTCGACGACGTCCCCTGTAGG - Intergenic
1021654182 7:22858756-22858778 TGCTGCAAAAATTCCCCTTCTGG + Intergenic
1022622857 7:32002495-32002517 TGATCCACAGAGTCCACTTCGGG + Intronic
1023171965 7:37398775-37398797 TGCTAGACTCAGTCCCCTGCTGG + Intronic
1024548469 7:50541150-50541172 TGTTCCGCATTGTCCCCTGCTGG + Intronic
1025523198 7:61768007-61768029 TGCTCCAAAATATCCCTTGCAGG + Intergenic
1029617663 7:101669512-101669534 TGCTCCACACTGCCTCCTGCTGG - Intergenic
1029649277 7:101879739-101879761 AGCTCCACCAAGGACCCTGCGGG - Intronic
1032571979 7:133010271-133010293 TGCTCCTCATATTCCCCTCCAGG - Intronic
1036767108 8:11556162-11556184 TACTCCATGAAGTCCCCTGAAGG - Intronic
1039787776 8:40848965-40848987 AGCTCTCCAAGGTCCCCTGCAGG + Intronic
1041292249 8:56319149-56319171 CCCTGCACAAAGTCCTCTGCGGG + Intronic
1045944355 8:107778884-107778906 TGCTCAACAAAATCACCTGGAGG + Intergenic
1046762159 8:118032342-118032364 TGCTCCACAGAGTCCCCCAGGGG + Intronic
1048019750 8:130527416-130527438 TGCTGCAGAAGGTCCCCTCCAGG + Intergenic
1049556454 8:143284802-143284824 TGCTCCACAATGCCCCCTGCTGG + Intergenic
1049564916 8:143333041-143333063 TGCACCACTAAGTGCCCTGAAGG + Intronic
1057277041 9:93681446-93681468 TGACCCACAAAGTCCGCTGCTGG - Intergenic
1057487952 9:95500653-95500675 TGCTCCACAAGGGCTCCTGGGGG + Intronic
1058961806 9:109998865-109998887 TCCTCTACAAAGTCACCTGATGG - Intronic
1059165740 9:112074918-112074940 AGCTCAACAATGTCCCCTGGTGG + Intronic
1059489628 9:114656413-114656435 TGATTCAGAAACTCCCCTGCAGG - Intergenic
1060926009 9:127455676-127455698 AGCTCCTCAAAGTCCCTTGTGGG - Intronic
1061048981 9:128183031-128183053 TGCACCAGGGAGTCCCCTGCAGG + Intronic
1061285016 9:129617452-129617474 GGCACCACAGTGTCCCCTGCAGG + Intronic
1061369933 9:130192495-130192517 CGCTCCACAAAGTGACCTTCAGG - Intronic
1187652291 X:21422093-21422115 AGCCCCACAAAGTTCCCTGCTGG + Intronic
1192543836 X:71996679-71996701 TGCTGCCCAAGGTCCCATGCAGG + Intergenic
1197734403 X:129840077-129840099 TGTTCCACTGAGGCCCCTGCAGG - Intronic
1199459051 X:148062514-148062536 TGATCCAGAAATTCCACTGCTGG - Intergenic
1199641630 X:149868009-149868031 TGCTGCACAAAGTGCTCTGGGGG - Intergenic
1199969925 X:152852192-152852214 TTCTCCACACATCCCCCTGCTGG - Intronic
1200234021 X:154459645-154459667 AGCACCACCATGTCCCCTGCAGG - Intronic
1202075810 Y:21037150-21037172 TGCTCCACTAATGCCCTTGCTGG - Intergenic