ID: 1016469581

View in Genome Browser
Species Human (GRCh38)
Location 6:144361206-144361228
Sequence TATGGTGTAAAGAAAGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 232}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016469581_1016469585 -10 Left 1016469581 6:144361206-144361228 CCACCCACTTTCTTTACACCATA 0: 1
1: 0
2: 0
3: 11
4: 232
Right 1016469585 6:144361219-144361241 TTACACCATAGTTTGACTCAGGG 0: 1
1: 0
2: 0
3: 4
4: 101
1016469581_1016469586 -9 Left 1016469581 6:144361206-144361228 CCACCCACTTTCTTTACACCATA 0: 1
1: 0
2: 0
3: 11
4: 232
Right 1016469586 6:144361220-144361242 TACACCATAGTTTGACTCAGGGG 0: 1
1: 0
2: 0
3: 3
4: 77
1016469581_1016469588 -1 Left 1016469581 6:144361206-144361228 CCACCCACTTTCTTTACACCATA 0: 1
1: 0
2: 0
3: 11
4: 232
Right 1016469588 6:144361228-144361250 AGTTTGACTCAGGGGCTTGCTGG 0: 1
1: 0
2: 0
3: 11
4: 135
1016469581_1016469589 29 Left 1016469581 6:144361206-144361228 CCACCCACTTTCTTTACACCATA 0: 1
1: 0
2: 0
3: 11
4: 232
Right 1016469589 6:144361258-144361280 AAAGACTAGCTTGTAGTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016469581 Original CRISPR TATGGTGTAAAGAAAGTGGG TGG (reversed) Intronic
901363301 1:8722760-8722782 TATGGTCTAAAGTATGTTGGAGG + Intronic
904383509 1:30126976-30126998 TATGATGAAGAGAAAGTAGGAGG - Intergenic
904541498 1:31236799-31236821 TATGGAGGAAGGGAAGTGGGAGG + Intronic
906937738 1:50229146-50229168 CATGGTGTAAAGAATGTAGCAGG + Intergenic
906971928 1:50524562-50524584 TATGGTGTAAGGAAAGAGTCCGG + Intronic
908622390 1:65998638-65998660 TATGGTTTATGGAAACTGGGAGG + Intronic
909300778 1:74010517-74010539 TAGGGTTTAAAGAATGTGTGAGG - Intergenic
909481693 1:76133470-76133492 TATGGTGGAGAGACAGGGGGTGG - Intronic
909596768 1:77414398-77414420 TATGGGGTACTCAAAGTGGGAGG + Intronic
909633457 1:77790564-77790586 AATGGTGCAAAGAAAGGTGGGGG - Intronic
909753341 1:79191630-79191652 TGTTGTGTAAAGAAATTGGAAGG + Intergenic
910366621 1:86472196-86472218 AGTGGTTTCAAGAAAGTGGGAGG - Intronic
910651979 1:89579306-89579328 TATGGTTTAATGAATGTGAGTGG + Intronic
910884706 1:91952324-91952346 TAGGCTGTAAAGACAGTGGGTGG + Intronic
912113160 1:106369011-106369033 TAAGATGGTAAGAAAGTGGGAGG - Intergenic
913695426 1:121320205-121320227 TAAGGTAGAGAGAAAGTGGGAGG - Intronic
914142139 1:144959855-144959877 TAAGGTAGAGAGAAAGTGGGAGG + Intronic
915385323 1:155486360-155486382 TATAATGTGAAGAAAGTGTGTGG - Intronic
916425961 1:164680140-164680162 CATGGTTTAATGAAAGTGGAAGG + Intronic
917229347 1:172819264-172819286 AATGCTGAAAAGAAAGGGGGAGG - Intergenic
917383555 1:174441854-174441876 GTTGGTGGAAAGAAAGAGGGAGG + Intronic
917442872 1:175082438-175082460 CATGGTGTAAAAGAATTGGGAGG - Intronic
918180732 1:182084420-182084442 TATGGTGAAAAACAAGAGGGAGG - Intergenic
919064624 1:192678062-192678084 AATCGTGTAAAGAAAGAGGTGGG + Intergenic
919516551 1:198532602-198532624 TAAGGGGTAAAGAAAGATGGTGG + Intronic
919805558 1:201379216-201379238 CAGGCTGTCAAGAAAGTGGGGGG + Intronic
920178877 1:204120409-204120431 TCTGGAGCAAACAAAGTGGGAGG - Intronic
920482755 1:206338584-206338606 TAAGGTAGAGAGAAAGTGGGAGG - Intronic
921126407 1:212181933-212181955 AATGGTGAAAAGAAAGAAGGGGG - Intergenic
921509556 1:216012235-216012257 CATGATGTAAAGAAAATGAGAGG - Intronic
921527787 1:216239618-216239640 TATGGTGAAAAGCAAATGGAAGG + Intronic
921714618 1:218405177-218405199 TAGGGTCTGTAGAAAGTGGGCGG - Exonic
922992638 1:229928087-229928109 TATGATTTAAAGTAAATGGGAGG + Intergenic
924189736 1:241538041-241538063 TATGGGGTAAAGAAGCAGGGTGG + Intronic
1064671080 10:17714316-17714338 CATTGTGTAAAAAAAGTTGGGGG - Intronic
1065395964 10:25238204-25238226 TATGGAGTGAAGAAACTGGAAGG - Intronic
1065691890 10:28342695-28342717 TGTGGTGTAAAGAAGGGGGCTGG + Intergenic
1065963963 10:30755675-30755697 TTTCGTGTAAAGAAGGTGTGGGG + Intergenic
1068789660 10:61013681-61013703 TATGAGTTAGAGAAAGTGGGAGG + Intergenic
1069780086 10:70949904-70949926 TGAGGTGGAAAGAAGGTGGGAGG + Intergenic
1069927191 10:71858841-71858863 CATGGTGGAGAGACAGTGGGTGG + Intergenic
1070258178 10:74827693-74827715 GCAGGTGTGAAGAAAGTGGGTGG + Intronic
1072050754 10:91700852-91700874 TTGGGTTTAAAGAAAGGGGGTGG - Intergenic
1072430518 10:95366969-95366991 TCTGGTGTAAAGATTGTGGGAGG - Intronic
1075845395 10:125541080-125541102 GATGGTGAAAAGCAAGAGGGAGG + Intergenic
1080192293 11:29566644-29566666 TATGATATAAAGAAAGTGATTGG + Intergenic
1080340304 11:31255432-31255454 GAGGATGTAAAGAAAGTGGAAGG - Intronic
1083457212 11:62787097-62787119 TATGATGAAACGAAAGTGCGGGG - Exonic
1085322335 11:75582989-75583011 GATGGTCTAGAGGAAGTGGGTGG - Intergenic
1085860457 11:80227095-80227117 TAGTGTGTAAAGAAAGAGAGAGG - Intergenic
1086529712 11:87770503-87770525 CATGGTGTAATGACATTGGGTGG - Intergenic
1086658408 11:89385597-89385619 CATGGTGGAAAGAAAATGAGAGG - Intronic
1087657419 11:100941255-100941277 GATGGAGAAAAGAATGTGGGAGG + Intronic
1087800664 11:102499863-102499885 TATGGTGGAAAGCAAGAGGGAGG + Intergenic
1087930007 11:103966173-103966195 TATGGAGGACAGAATGTGGGTGG + Intronic
1088281954 11:108144044-108144066 TATGGTGAGAACAAAGTGAGGGG + Exonic
1089951147 11:122527967-122527989 TATGGTGTAAGGAAAGGGTCTGG + Intergenic
1091494921 12:964235-964257 TATGTTGAAAAGAAAGGTGGGGG + Intronic
1091796889 12:3302573-3302595 GATGATTTAAAGAATGTGGGAGG - Intergenic
1092189687 12:6510051-6510073 TATGAGGGAAAGAAAGTGTGGGG - Intronic
1094339159 12:29391184-29391206 AATGGTTTAGAGGAAGTGGGAGG + Intergenic
1094345659 12:29465694-29465716 TATGGTCAAAAGAAAGGGGCAGG - Intronic
1095091023 12:38105353-38105375 TATGGTGTAAAGAAGGGGTCTGG + Intergenic
1099665044 12:85617781-85617803 TATGGAGTAAAGAAAAGGCGAGG - Intergenic
1099913645 12:88864650-88864672 TATGGTGTAGGGCAAGTGGTTGG - Intergenic
1101492798 12:105224921-105224943 ATTGGGGTAAAGACAGTGGGAGG - Intronic
1104295423 12:127507522-127507544 TGTGGTGCAGAGAAAGTGGCTGG + Intergenic
1105806682 13:23955538-23955560 TTTTGTGAAAAGACAGTGGGCGG + Intergenic
1110029080 13:70582655-70582677 TTTGGAAAAAAGAAAGTGGGGGG - Intergenic
1110103864 13:71645217-71645239 TATGCAGTAAATAAAGAGGGGGG - Intronic
1110189343 13:72713477-72713499 GATGATGTAAAGTATGTGGGAGG - Intronic
1111569805 13:90069254-90069276 AATGGTGTAAAAAATGTGTGTGG - Intergenic
1113010675 13:105762133-105762155 TGTGGTGTCAAGACAGTGGGGGG + Intergenic
1113417204 13:110137646-110137668 TGTGTTGGAAAGAAAGTGGATGG - Intergenic
1115119560 14:29924794-29924816 TGTGGAGTTAAGGAAGTGGGAGG - Intronic
1116087470 14:40258718-40258740 TGTGGTAGAGAGAAAGTGGGAGG + Intergenic
1116939517 14:50776953-50776975 TATGGTTTACAGAATGTGGATGG - Exonic
1117350483 14:54876717-54876739 TTTTGTGTAATGAAAGTGGAAGG + Intronic
1119637660 14:76289911-76289933 TATGGTGACTAGAAAGAGGGAGG + Intergenic
1125910794 15:43436859-43436881 TATGGAGTAAAGAAATTATGGGG + Intronic
1126278526 15:46914794-46914816 TATGCTGTAAAGACAGAGGTTGG - Intergenic
1126961648 15:54003189-54003211 TTTGTTGGAAAAAAAGTGGGAGG + Intergenic
1127137505 15:55939911-55939933 AATGCTGTAATGAACGTGGGAGG - Intronic
1127213297 15:56798121-56798143 TCTGCTGTAAAGAAAGTGTTTGG + Intronic
1130201513 15:81832864-81832886 AAAGATGTAAATAAAGTGGGAGG - Intergenic
1131572785 15:93556092-93556114 TATGGTGTATAAAAGCTGGGAGG - Intergenic
1132108177 15:99080414-99080436 AATTGTGAAAAGACAGTGGGTGG - Intergenic
1135844212 16:25903778-25903800 TATTGTTTAGAGAATGTGGGAGG - Intronic
1137864531 16:51879691-51879713 TGTGGAGCAAAGAAAGGGGGTGG - Intergenic
1140380210 16:74480020-74480042 TATGTTTTTAACAAAGTGGGTGG - Intronic
1140938421 16:79697651-79697673 AAAAGTGGAAAGAAAGTGGGAGG - Intergenic
1146200959 17:30858072-30858094 TATGATGGACAGAAAGTGGTTGG + Intronic
1146282055 17:31550886-31550908 TATGGGGTATAGAATGAGGGAGG - Intergenic
1147500819 17:40961849-40961871 GATGTTCTAAAAAAAGTGGGGGG + Intronic
1153406678 18:4748681-4748703 TATGGTATAAACAAACTGGGAGG + Intergenic
1155037768 18:22039635-22039657 TAGGGTGCACAGAAACTGGGGGG - Intergenic
1156438037 18:37154724-37154746 TAAGCTGTAAAGAAAGAGGCTGG - Intronic
1157539715 18:48491884-48491906 TTTGGTGGTAAGAAAGTGGATGG + Intergenic
1157962088 18:52166334-52166356 TATGGTGGAGAGTATGTGGGGGG - Intergenic
1160483596 18:79265915-79265937 TATGGTGTAAAGAAGGGGTCCGG + Intronic
1162672730 19:12270979-12271001 AATGTTGCAAAGAAAGTTGGTGG + Intronic
1163884514 19:19954066-19954088 TAAGGTGAAAGGAAACTGGGAGG - Intergenic
1163908695 19:20169559-20169581 TAAGGTGAAAGGAAACTGGGAGG + Intronic
1165597786 19:37025160-37025182 TATGATGTACAGAAAGTTGGCGG + Intronic
926478511 2:13358315-13358337 GATGAGGTAAAGAAAGTGTGAGG + Intergenic
927648560 2:24897126-24897148 TATGGTTGAAAGAGGGTGGGTGG - Intronic
928067679 2:28182947-28182969 TATCTTGTAAAGTAAGTGGAAGG - Intronic
928133010 2:28667015-28667037 GATGGTGTAAAGACAGTTGGTGG - Intergenic
928726267 2:34177317-34177339 TATGGGGTAGAGAAACAGGGTGG + Intergenic
930586397 2:53272247-53272269 TATGGTGTAAGGAAGGTGTCCGG - Intergenic
930614247 2:53577148-53577170 TATGGGGTCATGAAAGGGGGAGG + Intronic
930748514 2:54909074-54909096 TATGGTGTAAAGTGAGTTGTTGG + Intronic
930957884 2:57225963-57225985 TATGGTATAAGCAAAGTGGAAGG - Intergenic
931565449 2:63611434-63611456 TATTGTTAAAAAAAAGTGGGGGG - Intronic
934937923 2:98478574-98478596 TTTGTTGCAAAGAAAGTCGGGGG - Intronic
935401370 2:102663833-102663855 TCTTGTGAAAAGAAAGTGGTGGG + Intronic
937446485 2:121962871-121962893 TGTGGAGGAAAGAGAGTGGGAGG - Intergenic
938308320 2:130269032-130269054 TATGGGGGAAACAGAGTGGGAGG - Intergenic
938447009 2:131387804-131387826 TATGGGGGAAACAGAGTGGGAGG + Intergenic
939107014 2:137960977-137960999 TATGGTGTAAAGAAGGGATGCGG - Intergenic
941215287 2:162699781-162699803 AATGTTCTAAAGAAAATGGGAGG + Intronic
942306705 2:174615271-174615293 TATTTTGTATAGGAAGTGGGAGG - Intronic
942670498 2:178370330-178370352 TTTGGTGTCATGTAAGTGGGAGG - Intronic
943205601 2:184890301-184890323 TGTGGTGAAAATAAAGTTGGGGG - Intronic
943262855 2:185688037-185688059 CACGGTGTAAACAAAGTGGTAGG - Intergenic
947389334 2:229623318-229623340 TAAGTTGCAAAGAAGGTGGGTGG - Intronic
949055193 2:241924192-241924214 TGATGTGGAAAGAAAGTGGGAGG - Intergenic
1169798190 20:9487937-9487959 CATGGTATAAAGAGAATGGGGGG + Intergenic
1170992857 20:21320978-21321000 TATGGTGAAGAGCAACTGGGAGG - Intronic
1173197522 20:40928155-40928177 GATTGTATAAAGCAAGTGGGGGG - Intergenic
1173265158 20:41472456-41472478 TATGTGGTGAAGAAGGTGGGTGG - Intronic
1176997438 21:15572215-15572237 GATGATTTAAAGAATGTGGGAGG - Intergenic
1177255584 21:18657424-18657446 TATGGAGTGAAGGAAGTGGAAGG + Intergenic
1178333956 21:31727410-31727432 GATGATGCAAAAAAAGTGGGAGG + Intronic
1179168916 21:38957779-38957801 TATGGGGTAAAGACAGCTGGGGG + Intergenic
1179178425 21:39025448-39025470 CATGGTGGAAAGCAAGGGGGTGG + Intergenic
1182178134 22:28314691-28314713 TTTGGTATAAAGAAATAGGGAGG - Intronic
1182962465 22:34488535-34488557 CATGGAGTAAAGAAAGTGCTAGG + Intergenic
949472389 3:4410116-4410138 TATGGTGTGAACAGATTGGGGGG - Intronic
952820991 3:37485364-37485386 GATGGTGGAAAGACCGTGGGAGG + Intronic
953428324 3:42814903-42814925 TAGGATGTAAATAAATTGGGAGG + Intronic
953695188 3:45152738-45152760 TTTGATGGAAAGAAAGTGGAGGG + Intergenic
954227479 3:49191598-49191620 GATGGTGGAGAGGAAGTGGGCGG + Intronic
954976667 3:54702074-54702096 TATGGTGAAAAGAAAGGGCCTGG - Intronic
955245471 3:57220882-57220904 TGAGGTGTAAAGAAAGGGAGAGG - Intronic
958966580 3:100565019-100565041 TATGGTGAAAAGAGTATGGGTGG + Intronic
959287316 3:104432110-104432132 TATGCTATAAAGAAACTGAGAGG - Intergenic
959458111 3:106589248-106589270 TATGTTGGAAAGAGAGAGGGTGG + Intergenic
959708810 3:109364011-109364033 TATTGTGTACAGAGAGGGGGAGG + Intergenic
959849034 3:111066860-111066882 TAGAGTGTAAAAGAAGTGGGAGG + Intergenic
960036436 3:113107249-113107271 TTTGTGGTAAAGAAAGAGGGTGG + Intergenic
963225623 3:142858796-142858818 AAAGGTGTAAAGAAATTGGCTGG - Intronic
963632786 3:147754192-147754214 TATAGTGAAAAAAAAGGGGGTGG + Intergenic
964534081 3:157700363-157700385 CATGGTGTAAAGAGGGTGTGGGG - Intergenic
965628089 3:170702244-170702266 CATGGTGTCAAGAAAGTTAGAGG - Intronic
965968549 3:174526179-174526201 GATGATGAAACGAAAGTGGGAGG - Intronic
966233421 3:177673884-177673906 TATGGTGTAAGGATAGTGGTAGG + Intergenic
967668245 3:192200534-192200556 TATGGGGGAAACAATGTGGGAGG - Intronic
970763408 4:19517942-19517964 AATGGTTTAAAAAAAGGGGGTGG + Intergenic
970805223 4:20023223-20023245 TATGGTGGAAGGCAAGTTGGAGG - Intergenic
975436752 4:74362794-74362816 TATGCTGAAAAGAAAGATGGTGG - Intergenic
975598849 4:76078339-76078361 TATAATGTAAGGAATGTGGGAGG + Intronic
976569440 4:86591918-86591940 TATGTTATAAAGGAAGTGGCTGG + Intronic
980415113 4:132477579-132477601 CATGATGAAAAAAAAGTGGGGGG - Intergenic
980863442 4:138526467-138526489 TATGGTGAAAAGTAAGTGTCTGG - Intergenic
981410370 4:144423112-144423134 TATGTTGGAAAAAAAGTGAGAGG + Intergenic
981537521 4:145815133-145815155 AGTGGTATGAAGAAAGTGGGAGG + Intronic
982147962 4:152418312-152418334 TAAGGTGTGAAGAAAATGGTTGG + Intronic
983998751 4:174216016-174216038 TATGGAATAAAGAAAGCTGGGGG - Intergenic
984084005 4:175285775-175285797 TATGGATTAAAGTAAGTGGTAGG + Intergenic
986660320 5:10053556-10053578 TAGGGTATAAATAAGGTGGGGGG + Intergenic
989136822 5:38164058-38164080 TATGGAGTAGAGGAAGTAGGAGG - Intergenic
990829562 5:59941482-59941504 TATGGTGAAAGGCAATTGGGAGG - Intronic
992877736 5:81074480-81074502 TATTACGTATAGAAAGTGGGGGG - Intronic
994397813 5:99240617-99240639 TGTGGTGGTCAGAAAGTGGGAGG + Intergenic
994557189 5:101318974-101318996 TATGATGGAAAGAAAATGAGAGG - Intergenic
998627910 5:143866536-143866558 TATAGAGCAAAGAAAGTTGGTGG + Intergenic
999827988 5:155292397-155292419 CAGGGTGTGAAGAAATTGGGAGG + Intergenic
1001236680 5:170035687-170035709 TATGGTGTCAAGGAGGAGGGTGG + Intronic
1002578417 5:180191991-180192013 TGTGTTGTGGAGAAAGTGGGTGG - Intronic
1003603491 6:7540351-7540373 TATGTTGTAAAGGGAGTGGGGGG - Intergenic
1009737285 6:67692184-67692206 TATGGTGTACAGAAAATTTGGGG - Intergenic
1014290500 6:119552477-119552499 TATGGTGTATAGAATTTGTGGGG + Intergenic
1014367455 6:120562530-120562552 TATGGTGTAAGGAAAGGGTCCGG + Intergenic
1014751757 6:125264835-125264857 TATGGTGTGCAGAAATTGGTTGG - Intronic
1015409210 6:132873125-132873147 AATGATGCAGAGAAAGTGGGTGG - Intergenic
1016238019 6:141891169-141891191 TATGGTGTAAAGAAGGGGTCTGG - Intergenic
1016469581 6:144361206-144361228 TATGGTGTAAAGAAAGTGGGTGG - Intronic
1016833826 6:148457181-148457203 TAAGGTGTAAAAAAAAGGGGCGG - Intronic
1016958437 6:149648928-149648950 TGTGGTGAAAATCAAGTGGGAGG - Intronic
1020433990 7:8142564-8142586 TATGGTGAAAAGAAGGTGCAGGG + Intronic
1020612820 7:10422202-10422224 TTTTGTGTAAAGAAATTGGGTGG + Intergenic
1021269365 7:18566379-18566401 TCTGATGTAAAGAAAGGGAGAGG - Intronic
1024196996 7:47069018-47069040 TGTGGTGGAAAGAAGGTGAGAGG - Intergenic
1024377335 7:48654670-48654692 AATGATGTAAAGGAAGAGGGAGG - Intergenic
1025226447 7:57168862-57168884 TATGGAGAAAGGAATGTGGGCGG - Intergenic
1027249760 7:76391784-76391806 TATGGTGTCCAGAAAGAAGGAGG - Intronic
1027508921 7:79054576-79054598 TATGGTATGAAGAGAGTGGCTGG - Intronic
1027696159 7:81413234-81413256 CATGGTGGAAAGAAGATGGGGGG + Intergenic
1027875766 7:83766413-83766435 TATAGTGTAAAAAAATTGGTGGG + Intergenic
1030012106 7:105180389-105180411 TATGGTGTAAGGAAGGGGTGCGG - Intronic
1030811394 7:113976571-113976593 TATGGTGAAAAGATAGTAAGAGG + Intronic
1032350104 7:131154208-131154230 AATGGAGGAAAGAAAGTGGAGGG + Intronic
1032421370 7:131782610-131782632 GATGGGGTGGAGAAAGTGGGGGG - Intergenic
1035288529 7:157822017-157822039 GATGGTGTATAGATAGAGGGAGG - Intronic
1035895421 8:3394613-3394635 TCTGGTGTAGAAAAAGTTGGGGG + Intronic
1036633137 8:10529485-10529507 TCTGGTGGAAAGAAAGAGAGTGG - Exonic
1038529494 8:28306313-28306335 TTTGGGGTAAAGAAAGTGCAAGG + Intergenic
1038809076 8:30821743-30821765 GATGGCGCCAAGAAAGTGGGGGG - Intergenic
1039513376 8:38109787-38109809 TATGGTGTCAATAATGTGGTTGG - Intronic
1040775360 8:51036789-51036811 TATAATGTAAAGCAAGTTGGTGG - Intergenic
1041528635 8:58837584-58837606 TATGGTGTAAATACATTTGGGGG + Intronic
1043113064 8:76212757-76212779 AATTGTGTAAAGAAAGAGGATGG - Intergenic
1044091359 8:88006381-88006403 TATGGTGGAAAGGAACTGGGTGG + Intergenic
1044902485 8:96962327-96962349 GATGGTGAAAAGGAAGTTGGGGG + Intronic
1044922268 8:97179140-97179162 TATGATGGAAAGAAAATGAGAGG - Intergenic
1045355988 8:101389525-101389547 AAAGGTATAAACAAAGTGGGTGG - Intergenic
1048280523 8:133102413-133102435 TTTGGTCTGAAGAAAATGGGTGG - Intronic
1050974409 9:11918846-11918868 TATGCTTTAAAAAATGTGGGAGG + Intergenic
1051329911 9:16013240-16013262 TGTGATGGAAAGAAAGAGGGTGG - Intronic
1055403887 9:75953919-75953941 TAAGGTGCAAAGAGAGAGGGAGG - Intronic
1062529503 9:136993712-136993734 TATGGTGTGGAGAAAGGGGTGGG - Intronic
1186314616 X:8355870-8355892 TAGGGTGGAAACAAAGTTGGTGG + Intergenic
1186926465 X:14338031-14338053 TATGGAGAAAAGAGAGTTGGTGG - Intergenic
1187185338 X:16979230-16979252 TAGGGTGTCAAGTATGTGGGAGG + Intronic
1188155081 X:26731792-26731814 TAAGGTGTAAGGAAAGGGTGAGG + Intergenic
1188793596 X:34435747-34435769 TTTGGTGAAAAGAAAGTGCATGG + Intergenic
1188938784 X:36211482-36211504 GATATTGTAAAGAAACTGGGAGG + Intergenic
1190618050 X:52258409-52258431 TAAGTTGGAAAGAAATTGGGAGG + Intergenic
1191886544 X:65894331-65894353 CACGGTGTAAACAAAGTGGCAGG - Intergenic
1193019932 X:76780760-76780782 TACAGTGTAAACAAAGTGGCAGG - Intergenic
1193068604 X:77283190-77283212 TACGGTGTAAAGAAAGCTGCTGG + Intergenic
1193577891 X:83226305-83226327 TATGATGTAAGGAAGGTGGCTGG + Intergenic
1194142686 X:90223987-90224009 TATGGTGTGGAGAAAATGAGGGG - Intergenic
1194875756 X:99185798-99185820 TATGGTGTGAAAAAACTGAGAGG + Intergenic
1195322942 X:103735455-103735477 TTTGGGGTAAAGAAATGGGGAGG - Intergenic
1196603573 X:117629205-117629227 AATTGTGTAAAAAAGGTGGGAGG + Intergenic
1198103961 X:133445177-133445199 TCTGGTGTCAAGACAGCGGGAGG + Intergenic
1198671805 X:139089161-139089183 TGTGTTGGAGAGAAAGTGGGAGG + Intronic
1198690119 X:139273515-139273537 AATGCTGCAAAGAATGTGGGAGG - Intergenic
1199547601 X:149022916-149022938 TATGGTGTAAGGAAGGTGTCCGG - Intergenic
1200488443 Y:3793090-3793112 TATGGTGTGGAGAAAATGAGGGG - Intergenic
1201769399 Y:17604390-17604412 TATGGTGTAAAGAAGGGGTCTGG - Intergenic
1201832155 Y:18301595-18301617 TATGGTGTAAAGAAGGGGTCTGG + Intergenic