ID: 1016471411

View in Genome Browser
Species Human (GRCh38)
Location 6:144378549-144378571
Sequence GAGAACAGGGTGAAGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016471405_1016471411 7 Left 1016471405 6:144378519-144378541 CCTGCAATGTTCGTCTGAATTAA 0: 1
1: 0
2: 1
3: 8
4: 547
Right 1016471411 6:144378549-144378571 GAGAACAGGGTGAAGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016471411 Original CRISPR GAGAACAGGGTGAAGGAGGC AGG Intronic
No off target data available for this crispr