ID: 1016473674

View in Genome Browser
Species Human (GRCh38)
Location 6:144402670-144402692
Sequence GACTTCCTCCCTCTTCATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 165}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016473674_1016473675 0 Left 1016473674 6:144402670-144402692 CCAGTATGAAGAGGGAGGAAGTC 0: 1
1: 0
2: 1
3: 10
4: 165
Right 1016473675 6:144402693-144402715 ACGAATTCCTGAGTTTTTATTGG 0: 1
1: 0
2: 1
3: 18
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016473674 Original CRISPR GACTTCCTCCCTCTTCATAC TGG (reversed) Intronic
902758767 1:18567121-18567143 GACATCCTTCCTGTTCTTACCGG - Intergenic
903986251 1:27231289-27231311 CACTTCCTCTCTCTCCATATAGG - Intergenic
905350319 1:37341275-37341297 GACTTCCTCCCTCTGAAAAATGG - Intergenic
906750523 1:48254888-48254910 GCTCTCCTCCCTCTTCATTCTGG + Intergenic
906780434 1:48568417-48568439 GCCTTTCTCCCTGTTCATCCTGG + Intronic
909293502 1:73913895-73913917 TACTTCCTCTCTCCTCAGACAGG + Intergenic
915728815 1:158038102-158038124 GCCTTCCTCCCTCATCAGCCAGG - Intronic
915919139 1:159961152-159961174 GACTTTCTCTCTCTTCTTCCTGG + Intergenic
917522962 1:175763196-175763218 GATTTCCTCACTCCTCACACAGG + Intergenic
918987224 1:191647843-191647865 GTCTTGCTCCCTCTCCATGCAGG - Intergenic
920102570 1:203526560-203526582 GATTTCCTCCCTTTTCTTTCAGG - Intergenic
920710861 1:208293714-208293736 TCCTTCCTCCCTCTTCAACCTGG + Intergenic
921723670 1:218501247-218501269 GAATCCCTCCCTCCACATACAGG - Intergenic
922150987 1:223004181-223004203 GAGTACCTACCTCTTCACACTGG + Exonic
1064894192 10:20215486-20215508 GACTGCCTCCCTTTGCAAACTGG + Intronic
1067792599 10:49299356-49299378 GACTTCTTTCCTCTTTATCCAGG - Intronic
1069336548 10:67358477-67358499 AGCTTCCTCCTTCTTCAAACTGG - Intronic
1069558480 10:69413412-69413434 GTATTTCTCCATCTTCATACAGG - Intronic
1071394838 10:85213077-85213099 GGCTTCTTCTCTCTTCATCCTGG - Intergenic
1073372962 10:103007189-103007211 GACCTACTCCCTGTTCGTACAGG - Intronic
1075775766 10:124985776-124985798 GGCTTGCTCCCTTTTCATCCAGG - Exonic
1076658941 10:132042563-132042585 GAGTTCCTCCCTCCCCATCCTGG + Intergenic
1077013183 11:388563-388585 GACTTCCTCCCGGTTCCCACTGG - Intergenic
1077421979 11:2455987-2456009 GACTTCATTCCTCTGCATATGGG - Intronic
1077456272 11:2683031-2683053 GACCTTCTCCCACTTCTTACAGG + Intronic
1078290600 11:10006711-10006733 GGCTTCCTCCCACTTCCTCCTGG + Intronic
1083270441 11:61569606-61569628 CACTTCCTCTCTCTCCATAGAGG - Intronic
1083912576 11:65718890-65718912 GACATCCTCCTTCTTGATGCTGG - Exonic
1084501877 11:69539927-69539949 GACTTCCTCCCTTCTGAGACAGG - Intergenic
1087115591 11:94521081-94521103 ATCTTCCTCTCTCTTCATTCAGG + Intergenic
1088774592 11:113070044-113070066 GACTTCCCCTCTCTTCAAATAGG - Intronic
1090085357 11:123645644-123645666 CACCTCCTCTCTCTTCATGCAGG + Exonic
1090248863 11:125237092-125237114 GGCTTGCTCCCTCATCATTCTGG + Intronic
1092922154 12:13242151-13242173 GACTTCCTCACTCTCCCTCCTGG - Intergenic
1093845825 12:23970180-23970202 GACTCCTTCCCTCTTCACAAAGG + Intergenic
1095110854 12:38294219-38294241 ACCTTCCTCCCTCTTCAACCTGG - Intergenic
1098356625 12:69618329-69618351 GGCTACCTCCCTCTTCAGAAGGG + Intergenic
1098587738 12:72174108-72174130 GACTTGCTCTCCCTTGATACTGG + Intronic
1102231668 12:111266810-111266832 GAAGACCTCCCTCTTCATCCAGG - Intronic
1113361082 13:109632218-109632240 GAGTTCCTCCCACTACATAAAGG + Intergenic
1116182389 14:41551438-41551460 CACTTTCTCCTTCTTCATACAGG - Intergenic
1116245964 14:42412321-42412343 TGCTTCCCCCCACTTCATACTGG + Intergenic
1120142867 14:80947780-80947802 GACTTTCTCCCTATGCCTACAGG - Intronic
1121655658 14:95593816-95593838 CACTTCCTCCCCCTTCAGCCAGG + Intergenic
1122782584 14:104149905-104149927 GACTTCCTTCCCCTTCACACGGG + Intronic
1127672342 15:61207269-61207291 GACTTTCTCCTTCATCCTACAGG + Intronic
1128912785 15:71531237-71531259 GACTTCCTCATTCATCCTACAGG + Intronic
1129592384 15:76928726-76928748 GACTTTCTCCCTATTCACATAGG - Intergenic
1130952706 15:88605116-88605138 GCCTTCCTTCCTCTTCATTTTGG - Intergenic
1140696875 16:77543422-77543444 GCCTTCCTCCTTCTACAGACAGG - Intergenic
1141719825 16:85750182-85750204 CCCTTCCTCCCTCTTCCTCCGGG + Intronic
1143090632 17:4447451-4447473 GAGTTCCTTCCTCTTCAGAATGG - Intronic
1143098615 17:4492147-4492169 GACTTCCTTCCTCTTCCTAACGG - Intergenic
1144460846 17:15457659-15457681 GAATCCCTCCCTCATCATCCAGG + Intronic
1146016943 17:29241352-29241374 GCCTTTCTACCTCTTCAAACAGG - Intergenic
1150827734 17:68491573-68491595 CACTTCCTCCCACTTCCTCCTGG - Intergenic
1152290824 17:79439056-79439078 GACTTTCTACCTCGTCATCCTGG - Intronic
1155233902 18:23799887-23799909 GAATTCCTCCCTCTTCTTCAGGG + Intronic
1157598878 18:48880603-48880625 CACTTGCTCCCCATTCATACAGG - Intergenic
1161363853 19:3867711-3867733 GACCTCCTCCCACATAATACTGG + Intronic
1161844790 19:6706647-6706669 GGCCTCCTCCCTCCTCAGACAGG + Intronic
1161844835 19:6706787-6706809 GGCCTCCTCCCTCCTCAGACGGG + Intronic
1161844850 19:6706828-6706850 GGCCTCCTCCCTCCTCAGACAGG + Intronic
1161844864 19:6706874-6706896 GGTTTCCTCCCTCCTCAGACAGG + Intronic
1161844910 19:6706997-6707019 GGCATCCTCCCTCCTCAGACAGG + Intronic
1164517382 19:28947980-28948002 GACCTCCTCCCTCTACTTGCAGG + Intergenic
1165147336 19:33739376-33739398 GCCTTCCTCCCCCTTCATCAGGG + Intronic
1165383372 19:35496067-35496089 GCCTCCCTCCCTCTGCATCCTGG + Intergenic
1168291169 19:55358432-55358454 GATTCCTTCCCTCTTCAGACTGG + Exonic
926108665 2:10168354-10168376 GATCTCCTCCATCTTCATCCTGG + Intronic
926285079 2:11482275-11482297 GCCGTCCTCCCTCCTCTTACGGG - Intergenic
926933116 2:18060550-18060572 GACTTCCTCCATGTACATACTGG + Intronic
927508548 2:23630017-23630039 GGCTTCCTCCTTCTTCCTTCTGG - Intronic
932883364 2:75524796-75524818 TATTTCCTCCTTCTTCCTACAGG + Intronic
937401759 2:121589924-121589946 GTCTTCCTCCTCCTTCATATAGG + Intronic
937983108 2:127626438-127626460 GCCTTCCTCCCTCCTCCTAAAGG + Intronic
940327262 2:152438428-152438450 TACTTTCTCCCTCTTCCTCCAGG - Intronic
940662013 2:156558090-156558112 TACTTCCTTCCTATTCTTACTGG + Intronic
943108524 2:183577127-183577149 GACTTTCTCAATCTTCACACTGG - Intergenic
943283105 2:185963208-185963230 GCCTTCCTCCCTCTGCATGGGGG - Intergenic
947399686 2:229718652-229718674 TACTTCCTACCTCATCATGCTGG - Intergenic
948490613 2:238310307-238310329 GACTTCCTCCTTCCTCCTTCAGG + Intergenic
1169361867 20:4957104-4957126 GCCTCCTTCCCTCTTCTTACTGG + Intronic
1169978513 20:11357565-11357587 AACTTCCTCCCCCTTCCTGCTGG + Intergenic
1170503307 20:16997314-16997336 GACTTTCTCCCTGGTCATAGTGG - Intergenic
1171233950 20:23509538-23509560 GCCTGCCTCCCACTTCAGACAGG + Intergenic
1171414614 20:24969252-24969274 TACTTCCCCTCTGTTCATACTGG - Intronic
1175364120 20:58439589-58439611 GGCTTCTGCCCTCTTGATACTGG + Intronic
1175489106 20:59366851-59366873 AACTTCCTTCATCTCCATACTGG + Intergenic
1176587792 21:8606036-8606058 GATTTCTTTCCTCTTCATAAAGG + Intergenic
1179166090 21:38936368-38936390 GATTACCACCCTCTTCCTACTGG + Intergenic
1180270624 22:10583035-10583057 GATTTCTTTCCTCTTCATAAAGG + Intergenic
1180645056 22:17332173-17332195 GACGTCCTCCCTTTTCACAGGGG + Intergenic
1184841639 22:47055664-47055686 CACTCCCTCCCTCTCCATGCTGG - Intronic
1184935393 22:47716852-47716874 GCCTTCCTCCTTCTGCACACGGG - Intergenic
949139559 3:615709-615731 GATTTCTTTCCTCTTCATAAAGG - Intergenic
949563330 3:5222701-5222723 GACATCCCTTCTCTTCATACGGG - Intergenic
950340081 3:12235613-12235635 AACTTTCTCCTTCTTCATACTGG - Intergenic
951107796 3:18765736-18765758 GACTTGCACCCTTTTCAAACTGG - Intergenic
953582429 3:44169045-44169067 GACTTCTTCCCACTCCAGACAGG + Intergenic
961825772 3:129598333-129598355 GACCTCCTCCCTCACCATTCTGG + Intronic
963290411 3:143481406-143481428 GTCTTCCTCCCTATTCACTCAGG - Intronic
963380754 3:144526844-144526866 TACTTCCACCCTCTACATAAAGG + Intergenic
963763297 3:149307575-149307597 CACTTCCTTCCTCTTTCTACAGG + Intergenic
963991620 3:151663023-151663045 CACTTCCTCCCCCTTCATATAGG - Intergenic
966253009 3:177887842-177887864 GACTTCCTGCCTCTCCATCTAGG + Intergenic
967091937 3:186142036-186142058 GACTTACTCCCTTCTCAAACTGG - Intronic
969135783 4:5027688-5027710 TACTTCCTCCCTCCTGTTACAGG + Intergenic
969191654 4:5526194-5526216 GCCTTCTTCCCTCTACATACAGG + Exonic
969254801 4:5994476-5994498 GACTTCCTCTGTCTTCCTCCAGG - Intergenic
973631370 4:52823960-52823982 GTCTGCCTCCTTCTTCATATGGG + Intergenic
973789478 4:54365064-54365086 GGCTTCATCCCTATTTATACAGG + Intergenic
973863399 4:55087648-55087670 TACTTCCTCCTCCTCCATACAGG + Exonic
974493584 4:62598053-62598075 GACTTCCTCTCACATCTTACTGG - Intergenic
975647903 4:76563913-76563935 GCCTTCCTGCCCCTTCATACAGG - Intronic
976655300 4:87482331-87482353 GGCTACCTACCTCTGCATACTGG - Intronic
978147647 4:105394890-105394912 GACCCCCTCCTCCTTCATACTGG + Intronic
985294589 4:188422047-188422069 GACTTCCTTCACCTTCATGCAGG + Intergenic
992894714 5:81236001-81236023 GACCACCTTCCTCTTCACACTGG + Intronic
994125022 5:96159278-96159300 GACACCCTCCCTCCTCATGCTGG + Intergenic
995735977 5:115299133-115299155 TACTTCCTCCTACTTCACACAGG - Intergenic
997779086 5:136639103-136639125 GACTTCATCCTCCTTCATTCAGG + Intergenic
999222809 5:149995518-149995540 GCGTTCCGCCCTCTTCATCCTGG + Exonic
999661082 5:153863462-153863484 TCCTTCCTCCCTGTTGATACAGG + Intergenic
1001401008 5:171446394-171446416 GACTGCCTGCCTCTTTCTACTGG - Intronic
1001938470 5:175724184-175724206 GACTTCCTCCCCCTTCTTACTGG - Intergenic
1002315547 5:178340989-178341011 CAGTTCCTCCATCTTCATAATGG - Intronic
1003952694 6:11130895-11130917 GACTTCCTCACTCTTCTTTATGG + Intronic
1006626202 6:35399717-35399739 ACCTACCACCCTCTTCATACAGG + Intronic
1007321252 6:41030368-41030390 GACCTCACCCCTCTTCCTACCGG + Exonic
1007357653 6:41332974-41332996 CACTTCCTTACTCTTCATCCAGG - Intergenic
1009446600 6:63749812-63749834 AACTTCCTCCCTCTTCAGCCTGG + Intronic
1014398982 6:120963883-120963905 GTATTACTCCCTCTTGATACAGG + Intergenic
1015701610 6:136041470-136041492 GTCTTCCACCATCTTCAGACTGG + Intronic
1016473674 6:144402670-144402692 GACTTCCTCCCTCTTCATACTGG - Intronic
1018268548 6:162051707-162051729 GCCTTCCTTCCTCTCCATCCTGG + Intronic
1019576787 7:1741440-1741462 GCCTGCCTCCCTCATCACACAGG + Intronic
1022455062 7:30551451-30551473 AACTTCCTCCTTCATCATTCGGG + Intronic
1022774640 7:33513282-33513304 CATTTCCTCCCTCTTTATTCTGG + Intronic
1023760852 7:43463899-43463921 GACTTCCACTCTCTTCACCCTGG - Intronic
1024574625 7:50753845-50753867 GGCTTCCTGCCTTTTCTTACTGG - Intronic
1025093081 7:56078863-56078885 GACTTACTGACTCTTCAAACTGG + Intronic
1026323851 7:69291624-69291646 TACTCCCTCTCTCTTCCTACAGG + Intergenic
1026959770 7:74400762-74400784 GGCTGCCTCCCCCTTCAGACTGG - Intronic
1031711856 7:125057789-125057811 GACGACCTCCCTCTTCTTATTGG + Intergenic
1033068846 7:138182994-138183016 TCCTTCCTCCCTCTCCATTCTGG - Intergenic
1033932912 7:146546485-146546507 GATTTCCTCACTCCTCCTACAGG - Intronic
1034188824 7:149198311-149198333 CGCTTTCTCCCTCTGCATACAGG + Exonic
1036522839 8:9507984-9508006 GATTTCCTACCTCTGCTTACTGG - Intergenic
1037315980 8:17599927-17599949 CACTTACTGCCTCTTCATTCTGG + Intronic
1039099996 8:33930585-33930607 CCCTTCTTCCCTCTTCATCCAGG + Intergenic
1039630747 8:39108574-39108596 TACTTCCTCCCTCTCCACAGTGG - Intronic
1047063469 8:121253527-121253549 CTCTGCCTCCCTCTTCATATAGG + Intergenic
1047336122 8:123938349-123938371 GATTTACTCCCTTTTCATTCAGG + Intronic
1047649836 8:126908731-126908753 GACTTCCTTCCTCTTGAGGCTGG + Intergenic
1047940216 8:129822131-129822153 TCCTTCCTCCCTTTTCATGCAGG - Intergenic
1049508439 8:143015846-143015868 GACTCCCTCCCCCCTCACACAGG - Intergenic
1049578442 8:143400200-143400222 GACTGCCTCCCCCATCAGACTGG - Intergenic
1051453930 9:17230697-17230719 TACTTTCTCCCTCCACATACTGG + Intronic
1051684896 9:19647938-19647960 AACTTCCTTCCTCTTCCTATTGG + Intronic
1051856822 9:21577047-21577069 GACTTGCACACACTTCATACAGG + Intergenic
1052015083 9:23453760-23453782 GACCTTCTCCCTCTGCATTCAGG + Intergenic
1052660670 9:31425695-31425717 GGCTTCTTTGCTCTTCATACAGG - Intergenic
1052811741 9:33066872-33066894 GACTTCTCTCATCTTCATACTGG - Intronic
1053145829 9:35711575-35711597 GACCCTCTGCCTCTTCATACCGG + Exonic
1059289444 9:113209687-113209709 GACTTCCTTCCTTATCATGCTGG - Intronic
1059667927 9:116466681-116466703 GACATCCTCCCTATTAACACTGG - Intronic
1059804435 9:117783399-117783421 CACTTCCTCTCTCCTTATACTGG - Intergenic
1203617756 Un_KI270749v1:84222-84244 GATTTCTTTCCTCTTCATAAAGG + Intergenic
1185469160 X:372346-372368 GTCTTCCTCCCCCTTCAAGCAGG + Intronic
1192730462 X:73797979-73798001 GTCTTCATCCCTCTTCAGACTGG - Intergenic
1195443140 X:104920943-104920965 CACTTCATCCCTCTTCAACCAGG - Intronic
1196154820 X:112417235-112417257 CAATACCTCTCTCTTCATACTGG - Intergenic
1198617754 X:138478141-138478163 GGCCTCCTCCCTCTGCAAACTGG - Intergenic
1200273981 X:154714610-154714632 GGCTTCCTCCAACTTCATGCCGG + Intronic
1201701807 Y:16890851-16890873 TTCTTCCTACCTCTTCATTCCGG - Intergenic
1201949562 Y:19549226-19549248 ATCTTCCTTCCTCTTCTTACAGG + Intergenic