ID: 1016479130

View in Genome Browser
Species Human (GRCh38)
Location 6:144462814-144462836
Sequence CTCAAGCAAATGTAGATCTT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 149}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016479130_1016479135 28 Left 1016479130 6:144462814-144462836 CCAAAGATCTACATTTGCTTGAG 0: 1
1: 0
2: 0
3: 9
4: 149
Right 1016479135 6:144462865-144462887 AGGTAAATCCAGAGGCCACTGGG 0: 1
1: 0
2: 2
3: 12
4: 146
1016479130_1016479133 20 Left 1016479130 6:144462814-144462836 CCAAAGATCTACATTTGCTTGAG 0: 1
1: 0
2: 0
3: 9
4: 149
Right 1016479133 6:144462857-144462879 AGCTTTTGAGGTAAATCCAGAGG 0: 1
1: 0
2: 2
3: 5
4: 132
1016479130_1016479134 27 Left 1016479130 6:144462814-144462836 CCAAAGATCTACATTTGCTTGAG 0: 1
1: 0
2: 0
3: 9
4: 149
Right 1016479134 6:144462864-144462886 GAGGTAAATCCAGAGGCCACTGG 0: 1
1: 0
2: 3
3: 5
4: 209
1016479130_1016479132 8 Left 1016479130 6:144462814-144462836 CCAAAGATCTACATTTGCTTGAG 0: 1
1: 0
2: 0
3: 9
4: 149
Right 1016479132 6:144462845-144462867 TCTCACACTCAGAGCTTTTGAGG 0: 1
1: 0
2: 0
3: 17
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016479130 Original CRISPR CTCAAGCAAATGTAGATCTT TGG (reversed) Exonic
903974717 1:27141922-27141944 CACAAGCCAATGTTGAACTTGGG - Intronic
909200128 1:72680713-72680735 CTCAAGCAAAGGTACATTTGAGG - Intergenic
909635611 1:77813851-77813873 CTGAAGAAAATGTAGATGTAAGG + Exonic
910498108 1:87856025-87856047 CTCCAGCAAATGTGAATCATAGG + Intergenic
911330899 1:96524719-96524741 ATCTAGGAAATGTGGATCTTAGG + Intergenic
913084300 1:115421968-115421990 CTCAAGAAAATGGAGTACTTAGG - Intergenic
916151791 1:161800019-161800041 CTCAAGCAGCTGTGGATGTTAGG + Intronic
916249267 1:162721067-162721089 CTCAATCAATTGTTGATGTTTGG + Intronic
919095377 1:193027820-193027842 CCCAATCAAAAGTAGATGTTTGG + Intronic
922345787 1:224695306-224695328 CTCATGCAACTGTAGAGATTTGG - Intronic
922782851 1:228267300-228267322 CCCAAGCAAATGTTTCTCTTTGG + Intronic
923074182 1:230594656-230594678 CTCAAATATATGTAAATCTTAGG + Intergenic
1063177201 10:3562135-3562157 CTTTAGGAAATGGAGATCTTAGG + Intergenic
1063382444 10:5594214-5594236 CTCAGGGAAAGGTTGATCTTGGG + Intergenic
1064837353 10:19548472-19548494 CCCAAGTAAAAGTAGATCTTTGG + Intronic
1067167293 10:43875551-43875573 CACAAACAAATCTAGTTCTTTGG + Intergenic
1067441318 10:46310581-46310603 CTCAAGCAGATGGAGATCATGGG - Intronic
1068383542 10:56293184-56293206 CTAAAGCAAATGTAGTTCCCTGG - Intergenic
1071827190 10:89336906-89336928 CCCAGGCAAATGTAGATAATGGG + Intronic
1073611072 10:104943897-104943919 CTCAAGCAACTGTATATATATGG - Intronic
1076221913 10:128740500-128740522 GTCAAGCAAATGTATTTTTTGGG - Intergenic
1079573549 11:21975004-21975026 CCCAAGCAATTGTATATCTCAGG + Intergenic
1087294690 11:96357291-96357313 CTCAAAAAAATGAAGGTCTTTGG + Intronic
1088443883 11:109902102-109902124 CTCCAGCCAACGTAGACCTTGGG - Intergenic
1098627405 12:72689454-72689476 ATAAAGCACATGTAGATCTCAGG + Intergenic
1104039108 12:125118013-125118035 CTCAACTAAATGGAGACCTTTGG + Intronic
1107691717 13:42960172-42960194 CTCAAACATATGTAGATCGAAGG + Intronic
1108340352 13:49493437-49493459 CTAAAGCAAATCAAGATTTTAGG - Exonic
1110232834 13:73184346-73184368 CTGAAGCAAATGTAGAGGTGTGG + Intergenic
1110399941 13:75078450-75078472 ATCAAGCAAATGAAAATATTAGG - Intergenic
1110772151 13:79362033-79362055 ATCATGCATATGTAGAACTTTGG - Intronic
1110841023 13:80143318-80143340 CCAAAGCAAATGTAGACATTAGG + Intergenic
1116216689 14:42025544-42025566 CACCAGCACATGTAGAACTTTGG - Intergenic
1116723041 14:48525333-48525355 GTCCAGCAAATCTAGCTCTTGGG - Intergenic
1117084399 14:52184449-52184471 CTAAAGCAATTGTACATCTATGG + Intergenic
1119212320 14:72841486-72841508 CTGAATGAAATGTAGAGCTTAGG - Intronic
1120034275 14:79678511-79678533 CACAATCAAAAGTAAATCTTTGG + Intronic
1121806030 14:96824090-96824112 CTCAATAAAATTAAGATCTTTGG - Intronic
1124878205 15:33616178-33616200 CTTAGGCAAATTTAGATCTATGG + Intronic
1125093657 15:35826131-35826153 CACAACCAAAAGCAGATCTTAGG + Intergenic
1125405856 15:39352001-39352023 CATAAGAAAATCTAGATCTTGGG - Intergenic
1128394859 15:67214396-67214418 CTCAAGCACATGTAGACCAGGGG + Intronic
1131038483 15:89241690-89241712 CCCAAGCAACTGGAGCTCTTGGG + Intergenic
1132411936 15:101586583-101586605 ATGAAGCAAAAGTAGTTCTTGGG + Intergenic
1133501970 16:6375376-6375398 GTCATGCACATGTAGAACTTTGG + Intronic
1136749616 16:32622300-32622322 CTCAAGCAATTCTCCATCTTTGG - Intergenic
1140870403 16:79101185-79101207 CTCATGCAAAGAGAGATCTTTGG + Intronic
1141908731 16:87044265-87044287 AGAAAGCAAATGAAGATCTTAGG + Intergenic
1203051749 16_KI270728v1_random:881510-881532 CTCAAGCAATTCTCCATCTTTGG - Intergenic
1146816291 17:35944662-35944684 CTGAAGCCCATGTAGATTTTTGG - Intergenic
1151264666 17:72945601-72945623 CAAAAGCAAATGCAGCTCTTGGG - Intronic
1151399436 17:73846295-73846317 CCCAAGGAAATGGAGAACTTTGG - Intergenic
1151992338 17:77583977-77583999 GTCAATAAAATGTTGATCTTTGG + Intergenic
1156556213 18:38071124-38071146 CTCAAGCACATGTTTATCTTGGG - Intergenic
1156679915 18:39575966-39575988 CTCAAGCAGCTGAAGACCTTAGG + Intergenic
1157097593 18:44700571-44700593 TTCAAGCAAATGCAAAGCTTAGG - Intronic
1162826462 19:13255436-13255458 CTCAAGCAACTGTAGCTGTTGGG - Intronic
1165729640 19:38136680-38136702 CTCAGTCAAATGCAGATCCTTGG + Intronic
1166427038 19:42688241-42688263 CTCAAGCAACTAAAGATTTTTGG - Intronic
1167783182 19:51613897-51613919 ATGAAGCAAATGTATACCTTCGG + Intronic
928632482 2:33208298-33208320 GTCATGGAAATGCAGATCTTGGG - Intronic
929323474 2:40576460-40576482 CTCAGGCAAAAGTATATCATCGG + Intronic
931866635 2:66419153-66419175 ATCAAGCAATTTTAGATCTCAGG - Intergenic
932906224 2:75755280-75755302 GTCAAACAAATCTAGTTCTTAGG + Intergenic
934484785 2:94695580-94695602 CTCAAGAAAATGGATATCCTTGG + Intergenic
935654895 2:105413711-105413733 CTCAAGCAATTGTCTTTCTTTGG + Intronic
938130384 2:128710471-128710493 CCCAGGCAAATGTAGATCAGGGG - Intergenic
942403990 2:175633709-175633731 CTTAAGTAAATGTAGCTCTGTGG + Intergenic
942606160 2:177693327-177693349 ATCAACCAAATGTTGATCTGTGG - Intronic
944507145 2:200424572-200424594 CTAAAGCACATGTTGACCTTAGG + Intronic
944687480 2:202130432-202130454 TTAAAGCAGGTGTAGATCTTAGG + Intronic
945572400 2:211485234-211485256 CTGAAGCAAAGGTAGATTCTGGG - Intronic
945930018 2:215845314-215845336 ATCAGGCACATCTAGATCTTGGG - Intergenic
946986557 2:225280294-225280316 GGCAAGAAAATGGAGATCTTTGG + Intergenic
1169617384 20:7464086-7464108 CTCAAAAAAATGTAGAGCTATGG + Intergenic
1175206042 20:57312165-57312187 TTCAAGCCAATGTGGGTCTTTGG - Intergenic
1175485717 20:59344661-59344683 CTCATGGAAATGAACATCTTGGG + Intergenic
1176709620 21:10137999-10138021 CTCAGGCAAACGTAGAATTTCGG - Intergenic
1181464576 22:23103987-23104009 CTCCTGCAAATGTTGGTCTTTGG - Intronic
949297061 3:2537233-2537255 CTCAAACAATTATATATCTTCGG - Intronic
952516791 3:34112541-34112563 CTTAAACAAATCTTGATCTTGGG - Intergenic
955762932 3:62308086-62308108 CTCTAGCAAATGTAAGTCTAAGG + Intergenic
957877133 3:86161784-86161806 CTCAAGCAGATGCAAATCTTTGG - Intergenic
958747609 3:98155697-98155719 CTGAAGGGAATCTAGATCTTTGG + Intergenic
958754133 3:98229618-98229640 CTGAAGGGAATCTAGATCTTTGG + Intergenic
958758446 3:98277118-98277140 CTGAAGGAAATCTTGATCTTTGG + Intergenic
960765104 3:121118611-121118633 CTCAATCAAATCTATATTTTAGG + Intronic
963309923 3:143698911-143698933 TTCCAGCACATGTAGATCCTGGG - Intronic
964859305 3:161183193-161183215 CTAAAGAATATGTTGATCTTTGG - Intronic
965174455 3:165313743-165313765 TTTAGGCAAATGTGGATCTTTGG - Intergenic
965475551 3:169150612-169150634 CTAAAACAAATGTATAGCTTCGG + Intronic
967787171 3:193509807-193509829 CTCAAGTAAATGTAGAAAGTAGG - Intronic
970984081 4:22135265-22135287 CTCAAGAAAAGGGAGATCTCAGG + Intergenic
972122877 4:35727713-35727735 CGCCAGGAAATGTGGATCTTTGG - Intergenic
974353153 4:60775577-60775599 GTCAAGTAAATGTCGATTTTAGG - Intergenic
976455639 4:85244136-85244158 ATCAAGAAGAGGTAGATCTTTGG + Intergenic
977351052 4:95887909-95887931 ATCTAGCAAAAGCAGATCTTCGG - Intergenic
977964954 4:103134669-103134691 GTCAAGCATATTTAGATATTTGG + Intronic
978670439 4:111242177-111242199 CCCACACAAATATAGATCTTTGG + Intergenic
980441447 4:132851726-132851748 CTCAGGCAAATGGAGATGTAGGG - Intergenic
980623000 4:135333737-135333759 CTTATGCAAATGTAAATATTAGG + Intergenic
980764088 4:137275994-137276016 CTTAAACAAATGTAGACCCTTGG - Intergenic
981009461 4:139910602-139910624 CTGAGGCAAATGGAGATATTAGG + Intronic
981197375 4:141937465-141937487 CTTCAGCAAATGTATATCTCTGG - Intergenic
982805477 4:159757484-159757506 TTCAAGAAAATATAGCTCTTAGG + Intergenic
984882258 4:184420367-184420389 CACAAGCAAATGGAGATATTTGG - Intronic
988360207 5:30227878-30227900 CTCAATCACTGGTAGATCTTTGG - Intergenic
989333925 5:40292154-40292176 CACAAGCTAAAGTACATCTTAGG + Intergenic
990097050 5:52129193-52129215 CTGTAACAAATGTACATCTTTGG + Intergenic
990194181 5:53294421-53294443 CTCATGCACATGTAGCTCATAGG - Intergenic
990631241 5:57672299-57672321 CTCAAGAAAATATAGGTTTTTGG + Intergenic
991501755 5:67283837-67283859 GTCAAGCAAGTCTGGATCTTGGG - Intergenic
993340015 5:86713377-86713399 GTCAAGAAATTGTTGATCTTGGG + Intergenic
994035096 5:95189717-95189739 CTCACGGAAATATAGACCTTAGG - Intronic
994979814 5:106859635-106859657 CTAAAGCAAATGTAATTCTCAGG + Intergenic
996349029 5:122518156-122518178 CTCAAGCAACTGCATTTCTTTGG + Intergenic
996947802 5:129091724-129091746 CTCAAGACAATCTAGATGTTAGG - Intergenic
999546129 5:152630639-152630661 CACAAGCAAATGAATACCTTTGG + Intergenic
1002786963 6:408941-408963 CTTAAGCAAGTGGAGGTCTTTGG - Exonic
1004466579 6:15891101-15891123 CTCAAGGAAGAGTAGATCTTAGG + Intergenic
1008071250 6:47101223-47101245 CTCAATCAAATATTGAGCTTAGG - Intergenic
1014462767 6:121717460-121717482 CTCAAAAAAATGTATTTCTTAGG + Intergenic
1014870129 6:126584401-126584423 CTGTACCAAATGTATATCTTTGG - Intergenic
1015397360 6:132750139-132750161 CTCAATGAAGTGGAGATCTTTGG + Intronic
1016479130 6:144462814-144462836 CTCAAGCAAATGTAGATCTTTGG - Exonic
1018293507 6:162317784-162317806 CTCAAGTAAATGTATATCCTGGG + Intronic
1021546361 7:21817378-21817400 TACAAGTAAATGTAGTTCTTAGG + Intronic
1023694640 7:42832216-42832238 CTCAAGCTAAAGTTCATCTTAGG + Intergenic
1024833850 7:53493268-53493290 CACAACCAAATGCAGATCTCGGG - Intergenic
1027126243 7:75558614-75558636 CTAAATCAAAGGAAGATCTTTGG - Intronic
1028167992 7:87561750-87561772 CTCAAGCAATTATTCATCTTTGG - Intronic
1031037469 7:116803820-116803842 CTGAAGAAAATGTGGATCCTCGG + Intergenic
1033540868 7:142354804-142354826 CTCTAGCAAATGATGATCGTTGG + Intergenic
1038440974 8:27570603-27570625 CTCAAGAAGATGAAGATCATGGG + Intergenic
1040792140 8:51244126-51244148 CTCAAGTAGAGGTGGATCTTTGG + Intergenic
1041706341 8:60850176-60850198 GTCAAGCAAAATTAGATCTGGGG + Intronic
1042651653 8:71049152-71049174 CCCCAGGAAATGAAGATCTTTGG - Intergenic
1043728028 8:83636707-83636729 GTCAAACAAATCTAGATGTTTGG + Intergenic
1044008376 8:86963926-86963948 CTGCTGCAAATGTAGATCATTGG - Intronic
1044758133 8:95488536-95488558 CTCAAGGAAGAGTAAATCTTTGG + Intergenic
1050194882 9:3071648-3071670 ATCAGGAAAATGTACATCTTGGG + Intergenic
1052031176 9:23630623-23630645 CTCCAGCAAATGCAGAGCATGGG + Intergenic
1053673008 9:40388789-40388811 CTCAAGAAAATGGATATCCTTGG - Intergenic
1053759127 9:41340020-41340042 CTCAGGCAAACGTAGAATTTCGG + Intergenic
1053922818 9:43015158-43015180 CTCAAGAAAATGGATATCCTTGG - Intergenic
1054327601 9:63721433-63721455 CTCAGGCAAACGTAGAATTTCGG - Intergenic
1054384117 9:64528855-64528877 CTCAAGAAAATGGATATCCTTGG - Intergenic
1054511617 9:65987494-65987516 CTCAAGAAAATGGATATCCTTGG + Intergenic
1056302827 9:85259214-85259236 CTCAACCAAACATACATCTTAGG + Intergenic
1058013461 9:100003936-100003958 CTGGAGCAAACCTAGATCTTGGG + Intronic
1058478824 9:105370012-105370034 CCCAAGCAAATGTTGAGCGTGGG + Intronic
1059038319 9:110784562-110784584 CTGAGATAAATGTAGATCTTGGG - Intronic
1059764070 9:117366714-117366736 CTCCAGCAACTGTAGCTCTCTGG + Intronic
1202794379 9_KI270719v1_random:106966-106988 CTCAGGCAAACGTAGAATTTCGG - Intergenic
1188441726 X:30220197-30220219 CTCATGCAATTGTAGATTCTAGG + Intergenic
1190473513 X:50806126-50806148 CTCAAGCAACTGGTGCTCTTGGG + Intronic
1192285017 X:69726478-69726500 CAAAAGCAAAAGTAAATCTTTGG + Intronic
1193032986 X:76919994-76920016 CTCAAGCCACTGTAGATCTCTGG - Intergenic
1199539223 X:148940274-148940296 TTCAAACAAATGCACATCTTAGG - Intronic