ID: 1016487470

View in Genome Browser
Species Human (GRCh38)
Location 6:144557641-144557663
Sequence AGGTGTTTACAGATGCATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 135}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016487470 Original CRISPR AGGTGTTTACAGATGCATCA GGG Intronic
904811817 1:33168242-33168264 TGGTCTTTACAGTTGCCTCATGG - Intronic
906795860 1:48695964-48695986 AGATGTTTAAAGATGAATCCAGG - Intronic
911456907 1:98136512-98136534 CAGTGTTTACAGATGTTTCATGG + Intergenic
914340468 1:146755763-146755785 AGGTGTTTAGAGAAACATTATGG + Intergenic
914756258 1:150563048-150563070 AGGTGCTCACAGCTGCAGCATGG + Intergenic
917932446 1:179832345-179832367 AGGGGTTCACAGATGCATTTGGG - Intergenic
921851185 1:219933779-219933801 ATTTGTTTACAGATCCATCTGGG + Intronic
923137788 1:231133670-231133692 AGATGTCAACAGATGCATCTGGG - Intergenic
923332607 1:232939572-232939594 ATGTGTTTACAGTAACATCAAGG - Intergenic
1062808684 10:445253-445275 AGTTGTATACAGATGCCCCATGG - Intronic
1063881075 10:10533122-10533144 AGGTGTTTACAGCTATATTATGG - Intergenic
1065566962 10:27021149-27021171 TGGTGTATACAGATACATAAAGG - Intronic
1066549844 10:36544459-36544481 GGATGTGTACACATGCATCAGGG - Intergenic
1067968165 10:50938050-50938072 AAATGTTTACATATGCATCAAGG - Intergenic
1068518322 10:58051196-58051218 GGGTATTTACAGATGCATAGAGG - Intergenic
1078671460 11:13369456-13369478 AGGCTTTAACAGATGCAGCATGG - Intronic
1078781906 11:14447092-14447114 AGGTGTGTACAGATGAGTGATGG - Intronic
1082686081 11:56241379-56241401 AGGTGTTTACAGTGGCAACGGGG - Intergenic
1086700772 11:89898311-89898333 TGGTGCTTACAGATTCATCTAGG - Intergenic
1086705397 11:89946216-89946238 TGGTGCTTACAGATTCATCTAGG + Intergenic
1087068019 11:94045730-94045752 GGCTGTTTACAGACGCTTCACGG + Exonic
1088830706 11:113533801-113533823 AGATGTTCACAGATACATGATGG - Intergenic
1090617060 11:128524205-128524227 AAGTGTTTACAGTTTAATCATGG - Intronic
1091090833 11:132769929-132769951 AGATGTTCACACAGGCATCATGG + Intronic
1092478901 12:8842518-8842540 GGGTGTTAACATATGCAACAGGG - Intronic
1098199940 12:68043778-68043800 AGGTGTTGAGAGATGAATGAAGG - Intergenic
1101279461 12:103237680-103237702 AGCTGTTGACAGATGCATGGGGG - Intronic
1104743501 12:131195540-131195562 CTGTGTTTACAGCTGGATCACGG - Intergenic
1104790832 12:131481144-131481166 CTGTGTTTACAGCTGGATCACGG + Intergenic
1105497375 13:20942518-20942540 AGGTGTTTACACGAGCAACAAGG + Intergenic
1106640177 13:31575982-31576004 AGTTGTTTAATGAGGCATCATGG - Intergenic
1109258521 13:60113973-60113995 AGTTGTTTGCATATGCCTCACGG - Intronic
1114902370 14:27079377-27079399 AGGTGTATATAGATGAATGATGG + Intergenic
1117049781 14:51848473-51848495 GGGTGTGTTCAGAAGCATCAAGG - Intronic
1117442527 14:55773481-55773503 ATGTGTATCCAAATGCATCAGGG - Intergenic
1120238228 14:81917527-81917549 AGGTGTTTTCCGATGAAGCATGG + Intergenic
1125294320 15:38185809-38185831 GGGTGCTTACAGAAGAATCAGGG + Intergenic
1125632225 15:41156602-41156624 TAGTTTTTACAGATGTATCATGG + Intergenic
1129688499 15:77699962-77699984 AGGACTTGACAGATGCCTCAGGG + Intronic
1136289671 16:29264080-29264102 GGGTGCTGACAGATGAATCATGG + Intergenic
1139993819 16:70961643-70961665 AGGTGTTTAGAGAAACATTATGG - Intronic
1141568325 16:84918451-84918473 GGGTGTTCAGAGATGCATCATGG + Intronic
1141821208 16:86447286-86447308 GGGTTTTTACAGAGGCAACAAGG - Intergenic
1142095407 16:88237060-88237082 GGGTGCTGACAGATGAATCATGG + Intergenic
1142693545 17:1621166-1621188 AGATCTTTACAGAGGAATCAGGG + Intronic
1154412159 18:14147286-14147308 AGGTGTTTCCAGTTGCGTGAGGG - Intergenic
1156472056 18:37383620-37383642 AGTGGTTTACAGATGCCACATGG - Intronic
1158366686 18:56744651-56744673 AGGTGATTTCAGGTGCAGCATGG - Intronic
1158519933 18:58163468-58163490 AAGTGCTTACAGAAGCATCAGGG - Intronic
1160362870 18:78298591-78298613 AGGGGTTTGCAGATGGATAAAGG + Intergenic
1162145429 19:8610207-8610229 AGGTATTTACACACTCATCACGG + Intronic
1162536454 19:11265323-11265345 TGGTGTTTAGAGAAGCATCCAGG - Intergenic
1165262588 19:34633452-34633474 AAGTGTTGACACATGCAACATGG + Intronic
1167290645 19:48623513-48623535 AGATGTTGACAGATGCACCGAGG - Intronic
1168502064 19:56901036-56901058 AGGTGGATTCAGATGCAACAGGG + Intergenic
926243837 2:11107529-11107551 AGGTGTCTACAGGTCCATGAAGG + Intergenic
927029587 2:19106560-19106582 AGATGTTTACACACTCATCAAGG + Intergenic
929673125 2:43895210-43895232 AGATGTTTATATATCCATCATGG - Intronic
931349447 2:61474309-61474331 TGTTGTTCAAAGATGCATCAGGG - Intergenic
933406554 2:81867128-81867150 AGGTATTTCCAAATGCATCCAGG + Intergenic
934967881 2:98738619-98738641 CGGTGTGAACAGAGGCATCATGG + Intergenic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
936833694 2:116681045-116681067 AGCTGTTCACAGTTGCAGCATGG + Intergenic
937541568 2:122961840-122961862 ATGTGTTTACACATGGCTCAAGG + Intergenic
939692456 2:145281461-145281483 AGGTGTTTACCCCTGTATCAGGG + Intergenic
940564134 2:155339008-155339030 TGGTGTTTACAGAAGCCTGATGG - Intergenic
940902511 2:159138573-159138595 AGGTGTGTACAGATACATGATGG + Intronic
941169625 2:162120771-162120793 ATGTGTACACACATGCATCAGGG + Intergenic
943635643 2:190303847-190303869 GGGTTTTGACAAATGCATCAGGG - Intronic
944435368 2:199683327-199683349 AGGTCCTTTCATATGCATCATGG - Intergenic
946997750 2:225414658-225414680 AGGTGTTCACAGATACACCCAGG - Intronic
1172551973 20:35808165-35808187 AGTTGTTTGCAGATACATGATGG - Intronic
1173100182 20:40080276-40080298 AGTTGTCTACAGATTCCTCATGG + Intergenic
1174530452 20:51208654-51208676 AAATGTTAACAGATGCATGAAGG + Intergenic
1175409456 20:58756637-58756659 AGATGTTTAAAGTTGCATCTAGG + Intergenic
1176860849 21:14010974-14010996 AGGTGTTTCCAGTTGCATGAGGG + Intergenic
1177234386 21:18368135-18368157 AGGTTTTTACAGATGCTTAAAGG - Intronic
1178701572 21:34837726-34837748 AGGTGTTCAGAGCTGCATCCTGG - Intronic
1179588344 21:42388474-42388496 AGGTGTTCACAGCTGCTTCGTGG - Exonic
1183877263 22:40794054-40794076 AGATGTTAACAGATGAATCTGGG + Intronic
952197516 3:31091781-31091803 TAGTGTTTCCAGATGCATCCAGG - Intergenic
960006215 3:112783783-112783805 TGGGGTTTACAGATGCAAAACGG + Intronic
960194846 3:114753093-114753115 AGGATTTTACAAATGCATCAAGG + Intronic
960475026 3:118113551-118113573 AGGTGTCTACAAATGTTTCAAGG + Intergenic
961917268 3:130390324-130390346 AGGTTTTTACAGATACAGCCTGG + Intronic
968902405 4:3437890-3437912 ACTTGTTCACAGATGCCTCATGG + Intronic
974136377 4:57823420-57823442 AGCTGACTACAGATGCATGAGGG + Intergenic
975651572 4:76598645-76598667 AGGTGGATACAGCTGCACCAGGG - Intronic
979788213 4:124743938-124743960 AGGTGCTTACAAATTCATGATGG + Intergenic
980691737 4:136304110-136304132 AGGTGCTTACTGATGAATCACGG - Intergenic
981071243 4:140541598-140541620 TGGTGTTTACAGATCCCTTAGGG + Intronic
981358391 4:143819144-143819166 AGGAGTTGACAAATGCCTCAAGG + Intergenic
983009110 4:162523034-162523056 AGAATTTTACAGATACATCAGGG - Intergenic
984219025 4:176950662-176950684 AAGTGTTGACAGAAGCAGCAAGG + Intergenic
986415346 5:7522563-7522585 AGGTGTTCACATATGGGTCAGGG + Intronic
989227070 5:39041041-39041063 GTCTGTTTACAGATGCATCCTGG + Intronic
989437317 5:41429936-41429958 AGGTGTTTCCAGGGGCATCAAGG - Intronic
995409710 5:111842131-111842153 AGGTGTTGGTAGGTGCATCAAGG - Intronic
997992677 5:138559014-138559036 ATGTGTTGACAAATACATCACGG + Intronic
998565751 5:143214589-143214611 ATGTGTTTACAGATGCAGCCAGG - Intronic
999117430 5:149176114-149176136 AGGTGTTGGCAGCTGCAGCAGGG - Intronic
1000975313 5:167758005-167758027 ATGTATTGACAGATGCATGAAGG - Intronic
1004680296 6:17887340-17887362 AGGTTGTTACTGTTGCATCACGG + Intronic
1006402039 6:33823292-33823314 AGGTGTTTACAGATACAATGGGG - Intergenic
1007961977 6:45968186-45968208 AGGGGTTTAGAGATGCATGATGG - Intronic
1008705659 6:54155630-54155652 AAGTGTTTGCAGTTTCATCAGGG + Intronic
1011087472 6:83558597-83558619 ATGGATTTAGAGATGCATCAAGG + Intronic
1011360046 6:86513875-86513897 ATGTGTTTTCAAATGCTTCATGG - Intergenic
1015085853 6:129291190-129291212 AGTTCTTTACAGATACATCAGGG - Intronic
1015876261 6:137825869-137825891 AGGTGTCTTCAAAAGCATCAAGG - Intergenic
1015876377 6:137826976-137826998 AGGTGTCTTCAAAAGCATCAAGG - Intergenic
1016487470 6:144557641-144557663 AGGTGTTTACAGATGCATCAGGG + Intronic
1017021884 6:150146651-150146673 TGGTGTGTGCAGAGGCATCATGG - Intronic
1018065085 6:160118974-160118996 AGGTGGTTGCAGCTGCATCCAGG + Intergenic
1022470391 7:30678510-30678532 AGTTATTTCCAGATGCAGCAGGG - Intronic
1026766627 7:73164237-73164259 GGGTGGCTACAGATGGATCAGGG + Intergenic
1027043105 7:74973936-74973958 GGGTGGCTACAGATGGATCAGGG + Intronic
1027080542 7:75228423-75228445 GGGTGGCTACAGATGGATCAGGG - Intergenic
1029389741 7:100267032-100267054 GGGTGGGTACAGATGGATCAGGG - Intronic
1030502952 7:110383262-110383284 ATGTGTTTATAGGTGCATAAGGG - Intergenic
1031282591 7:119822501-119822523 AGGTTTTTACGTATGCCTCATGG + Intergenic
1033797678 7:144867009-144867031 AAATGTTTACATATGCATTATGG - Intergenic
1036952146 8:13150996-13151018 AGATGTCTACAGATGGAACAGGG + Intronic
1038673805 8:29604611-29604633 AGGTGTTCACTGGTGCACCATGG - Intergenic
1040421413 8:47243382-47243404 AGGTTTCTACAGTTGCTTCAAGG - Intergenic
1041452929 8:58026528-58026550 AAGTGATTACAGATGATTCAAGG - Intronic
1043258818 8:78171400-78171422 AGGGCTTTACAGATACAGCACGG - Intergenic
1045646213 8:104301893-104301915 AGATGCTTCCAGATGGATCAAGG + Intergenic
1046644137 8:116766551-116766573 AGGCGTTTACTGATGCTTCCTGG + Exonic
1047053259 8:121137175-121137197 AGGTTGTTACAAATGCATTAAGG + Intergenic
1047874922 8:129125531-129125553 AGGTTTTTACAGAGGCGTGAAGG - Intergenic
1048068506 8:130997960-130997982 TGTAGTTTACAGATGCATAAGGG - Intronic
1048147672 8:131861685-131861707 AGCTGTTTAAAGATTCAACATGG - Intergenic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1056260596 9:84844164-84844186 AGGTCTTTTCAGCTGCAGCATGG + Intronic
1057093162 9:92278942-92278964 AAGGGTACACAGATGCATCAAGG - Intronic
1057823431 9:98352636-98352658 AGGTGTCTGCAGGTGCATGAGGG + Intronic
1062125301 9:134857278-134857300 AGCGGTTTACAGATGAATGAGGG + Intergenic
1186632469 X:11364800-11364822 AGGAGTAGATAGATGCATCAGGG + Intronic
1190522290 X:51292765-51292787 TGGTGCTTACAGCTGCTTCAAGG - Intergenic
1192234365 X:69286324-69286346 AGGTCTTTACTGATGCTTGAAGG - Intergenic
1194097019 X:89653799-89653821 AGGTTTTGACAAATGCATAATGG + Intergenic
1194937206 X:99965257-99965279 AGTGGTTTACAGATGCATCATGG + Intergenic
1197378155 X:125707839-125707861 AGATGATAACAGATGCTTCAAGG + Intergenic
1200450039 Y:3315179-3315201 AGGTTTTGACAAATGCATAATGG + Intergenic