ID: 1016492007

View in Genome Browser
Species Human (GRCh38)
Location 6:144615898-144615920
Sequence CTGATCATGTAGGACCTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 200}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016492007 Original CRISPR CTGATCATGTAGGACCTGGT AGG (reversed) Intronic
901229056 1:7631834-7631856 CTGATCATGAAGGCCTTGGCAGG - Intronic
901932422 1:12603960-12603982 CTGAGCCTGTAGGACTTGGATGG + Intronic
905654396 1:39676783-39676805 CCGATCATGCAGGACCTGGAGGG + Intergenic
906706299 1:47897331-47897353 CTGATCATTTTGGGCCTTGTAGG + Intronic
906824068 1:48959864-48959886 CAGATCATGTAGGGCCTTGTAGG + Intronic
908379984 1:63588630-63588652 CTGATCATATTGGGCCTTGTAGG - Intronic
908993677 1:70126478-70126500 CTGATCATCTGGGACTTGGGGGG + Intronic
913286902 1:117234880-117234902 TAGATCATGTAGGGCCTTGTGGG + Intergenic
915072913 1:153287162-153287184 TGGATCATGTAGGACCTTTTAGG + Intergenic
916521729 1:165569570-165569592 CACATCATTTAGGGCCTGGTGGG - Intergenic
919659139 1:200226414-200226436 CTGATCATTTAGCACATGGCAGG - Intergenic
922429080 1:225529220-225529242 CAGATCATGCAGGACCTTGCAGG - Intronic
923403237 1:233636139-233636161 CAGATCATGTAGGACCTTATGGG + Intronic
924721502 1:246627274-246627296 AAGATCATGTAGGGCCTTGTAGG - Intronic
1065427363 10:25619501-25619523 CTGATGATGTAGGCACTGGAGGG - Intergenic
1069859701 10:71462722-71462744 CTGATCACTGAGCACCTGGTGGG - Intronic
1071561088 10:86647292-86647314 CTGATCGTGTTGGGCCTGATGGG + Intergenic
1071986950 10:91061535-91061557 CAGATCATGGGGGACCTTGTAGG - Intergenic
1072010342 10:91298007-91298029 GTAATCCTGTAGGGCCTGGTGGG - Intergenic
1073732384 10:106305301-106305323 CTGCTCCTCTAGTACCTGGTCGG + Intergenic
1073788883 10:106919780-106919802 GTGACCATGTATGTCCTGGTTGG + Intronic
1074964241 10:118474560-118474582 CTGATCCTGTAGGTCTTGGGTGG + Intergenic
1082773124 11:57224242-57224264 CAGGTCATGTAGGACCTTGAAGG - Intergenic
1084440701 11:69171194-69171216 GCAATCATGAAGGACCTGGTGGG - Intergenic
1087039576 11:93785224-93785246 CAGATCATGTAGAACCCAGTAGG + Intronic
1091427790 12:406502-406524 CAGATCATACAGGACCTTGTCGG + Intronic
1092737353 12:11595093-11595115 CCGATCATGCAGGACATTGTAGG - Intergenic
1092755325 12:11757994-11758016 CTGGTCCTGTAGGCCCTGATGGG + Intronic
1092860118 12:12713029-12713051 CAGATCAGATAGGACCAGGTAGG - Intergenic
1093872786 12:24312330-24312352 CGGATTATTTAGGACCTGCTAGG - Intergenic
1095909270 12:47409372-47409394 CAGATCATGGAGGGCCTGGAAGG - Intergenic
1096201734 12:49688410-49688432 CAGATTATGTGGGACCTTGTTGG - Intronic
1097896526 12:64829104-64829126 CAGATCGTGGAGAACCTGGTGGG + Intronic
1099372647 12:81856320-81856342 CTGATCATACAGGAACTTGTAGG + Intergenic
1099496889 12:83359310-83359332 CAGATCATGTAGGATGTTGTAGG + Intergenic
1100140089 12:91607497-91607519 CTCATTATCTAGGACATGGTAGG + Intergenic
1100661290 12:96701804-96701826 CAGATCATGTAAGACCTCATAGG + Intronic
1101798769 12:108002320-108002342 CTGATCCTGTAGGACCTTGAGGG - Intergenic
1102520404 12:113474585-113474607 ATGATCATGAAGCACGTGGTGGG - Intergenic
1103268088 12:119647902-119647924 CTGATCATGTAGGGCTTTGCGGG - Intergenic
1103948383 12:124539411-124539433 GTGAGCATGAAGGAGCTGGTGGG - Intronic
1107111219 13:36700104-36700126 CAGACTATGTAGGAACTGGTAGG + Intergenic
1108994973 13:56718723-56718745 CAGATCATATATGACCTTGTAGG + Intergenic
1109647963 13:65285280-65285302 CTGATCATGTAGCACCATGCTGG - Intergenic
1110064765 13:71089386-71089408 CAGATCATGTAGAACCTGGTGGG + Intergenic
1110639217 13:77802530-77802552 AAGATCATGTAGGAGCTTGTAGG + Intergenic
1114383169 14:22230475-22230497 CTGAGCATGTAGGACATGCTAGG - Intergenic
1115732666 14:36287994-36288016 CAGATCATGTAGGGCCCTGTAGG + Intergenic
1117095852 14:52296560-52296582 CTTATCATGTAAGAAATGGTGGG + Intergenic
1117828730 14:59729288-59729310 CAGATCATGTAGGATCTCATGGG + Intronic
1119859022 14:77923441-77923463 CTGGTCAGGTAGGACTTTGTAGG + Intronic
1121210133 14:92202283-92202305 CAGATCCTGTGGGGCCTGGTGGG + Intergenic
1121752101 14:96365506-96365528 CACATCATGTAGGGCCTCGTAGG + Intronic
1125900629 15:43343337-43343359 CAGATCATGTGGGACCTTGTAGG - Intronic
1127486325 15:59421139-59421161 CTGATCCTGTAGACCCAGGTTGG + Intronic
1128280928 15:66393652-66393674 CTGGTCAGGTAGGGCCTTGTAGG - Intronic
1129196401 15:73969786-73969808 CAGCTCATGTAGGGCCTGGTAGG - Intergenic
1129988164 15:79936891-79936913 ATGAGCATGAAGGACCTGGGGGG - Intergenic
1129999723 15:80036038-80036060 CTGATTTAGTAGGTCCTGGTGGG + Intergenic
1131141697 15:89981637-89981659 CTAATAATGAAGGAACTGGTAGG - Intergenic
1132290221 15:100694977-100694999 CTGTTGATGTAGGACCTTGTGGG + Intergenic
1134819910 16:17238627-17238649 CTGGTCATGCAGGACCTTGTAGG - Intronic
1135052599 16:19204721-19204743 CTGATCAAGTAGGCTCTGGGAGG + Intronic
1138044357 16:53705312-53705334 CAGATCATGCAGGATCTTGTAGG - Intronic
1138369742 16:56517290-56517312 CAGATCATATAGGAACTTGTAGG - Intronic
1139607908 16:68033012-68033034 CTGATCATGCAGGGCCTTGTGGG + Intronic
1139608211 16:68035310-68035332 CAGATCATGTAGAGCCTTGTAGG - Intronic
1140161415 16:72498561-72498583 CTGCTCATGTAAGAACTGGAGGG + Intergenic
1142589678 17:997221-997243 CTGCTCCTGCAGTACCTGGTGGG + Exonic
1142619166 17:1154159-1154181 AGGATCATGAAGGACCTGGGAGG - Intronic
1143088946 17:4437102-4437124 CTGAGCATCTGGGAACTGGTGGG + Intronic
1143092964 17:4460201-4460223 CAGATCATGTAGGATGTTGTGGG + Intronic
1143474051 17:7192930-7192952 CAGAGCAGGTAGGACCTGGCGGG - Exonic
1150162939 17:62914699-62914721 CTGATCATGTAGAACCCTGAAGG - Intergenic
1150341943 17:64375510-64375532 CTGTTCATTTATTACCTGGTAGG - Intronic
1151272610 17:73008534-73008556 CTGATTAGGTTGAACCTGGTGGG - Intronic
1151712455 17:75814551-75814573 CTGATAATCTAGGCCCTGATAGG - Intronic
1156809684 18:41232408-41232430 CAGATTATGTAGGGCCTTGTGGG - Intergenic
1159076133 18:63683987-63684009 CGGATCATGTAGGAAGTGGTGGG - Intronic
1161361996 19:3855682-3855704 CTGGTCATGGCGGGCCTGGTGGG + Intronic
1161619195 19:5289533-5289555 CAGGTCGTGCAGGACCTGGTGGG - Intronic
1162579847 19:11522431-11522453 CTGATGGCGCAGGACCTGGTGGG - Intronic
1163221904 19:15927719-15927741 CAGAACATGTTGGACCTTGTAGG - Intronic
1163741156 19:19013742-19013764 GTGAACACGTAGGACCTGGTGGG + Intronic
1165322674 19:35095980-35096002 CAGATCCTGTAGGGCCTTGTGGG + Intergenic
1165661326 19:37582989-37583011 CAAATCATGTAGGACCTTGTTGG - Intronic
1165746240 19:38231290-38231312 CGGCTCATGTAGTACCTTGTAGG + Intergenic
1165882555 19:39053927-39053949 CAGATCATGTGAGGCCTGGTGGG - Intergenic
1166563672 19:43750164-43750186 CAAATCATGTAGGACCTGGTAGG - Intronic
1168486249 19:56764834-56764856 CCGATCGTGGAGGACCTGGAGGG - Intergenic
925807297 2:7663354-7663376 CTGCCCATATAGGGCCTGGTAGG - Intergenic
927601805 2:24449298-24449320 CAGATCATGTAGATCCTTGTAGG - Intergenic
927829299 2:26334755-26334777 CTTATCATGTAGGACTTTATAGG + Intronic
928067605 2:28182114-28182136 CTGATCATGTAGGGCCTTACAGG + Intronic
931065191 2:58578264-58578286 CAGATCATGCTGGACCTTGTGGG + Intergenic
934101255 2:88655360-88655382 CTTATCATGTAGGGGTTGGTAGG - Intergenic
935115778 2:100135145-100135167 CAGATCATGTAGCCCCTGATAGG + Intronic
936410296 2:112252581-112252603 CCAATCATGGAGGAACTGGTAGG - Intronic
937940791 2:127284321-127284343 CAGGTCTTGTAGGACCTTGTAGG - Intronic
939357961 2:141128419-141128441 CAGATTATGTAGGACCTGACTGG - Intronic
942028371 2:171933810-171933832 CTTATCATGTAGGATCTGTTTGG + Intronic
942177710 2:173350471-173350493 CAGATCATGTGGGACCTTCTTGG - Intergenic
944325777 2:198401825-198401847 CAGATCATGCAGGACCTTGTAGG - Intronic
944395529 2:199262213-199262235 CAGATCATGTAGGGCCTTGCAGG + Intergenic
944668573 2:201976528-201976550 AAGCTCATGTAGGACCTTGTAGG + Intergenic
946801028 2:223416182-223416204 CAGATCATGGAGTACATGGTAGG + Intergenic
946926375 2:224631211-224631233 CAGATCATGTAGAGCCTGATGGG + Intergenic
948202820 2:236142203-236142225 CAGATCACGTAGGACCTTGCAGG - Intergenic
948888344 2:240894999-240895021 CTGATGATGTTGCACCAGGTGGG - Intronic
948949462 2:241239597-241239619 GAGATCATTGAGGACCTGGTAGG - Exonic
1168799873 20:637526-637548 CTGTGCAAGCAGGACCTGGTGGG - Intergenic
1169608540 20:7351902-7351924 ATGATCATGTCTGTCCTGGTAGG + Intergenic
1172807105 20:37619913-37619935 CAGAACATGCAGGACCTCGTAGG + Intergenic
1173034194 20:39393081-39393103 CTGATCAAGTAGGAATGGGTGGG + Intergenic
1173430403 20:42982715-42982737 CTGCTCATCAAGGACCTGGGAGG - Intronic
1173587446 20:44193615-44193637 CAGATCATGGAGGGCCTGGTAGG - Intergenic
1174263112 20:49311743-49311765 CGGGTCATGTAGGCCCTTGTAGG + Intergenic
1174411549 20:50339856-50339878 AAGATCTTGTAGGGCCTGGTAGG - Intergenic
1177922371 21:27168712-27168734 CAGATCATATAGTACCTTGTGGG - Intergenic
1178942419 21:36917163-36917185 CAGATCATGTAGGAGCTGGCAGG - Intronic
1179444783 21:41423663-41423685 CTGAGCATGTAGGATGTGTTAGG - Intronic
1181888521 22:26040848-26040870 CAGATGATGTAGGGCCTTGTAGG + Intergenic
1182190381 22:28453908-28453930 TAGATCATGTATGACCTTGTAGG - Intronic
1183992335 22:41606054-41606076 CAGATCAGGTAGGTCCTGGGAGG + Intronic
1184302928 22:43573121-43573143 CTGATCATTTAGGAAATGGCAGG + Intronic
949571785 3:5300689-5300711 CTGATCAGGTAGGGGATGGTGGG + Intergenic
951738572 3:25895462-25895484 TGGATCATGTAGGACCTTGTAGG - Intergenic
955833831 3:63031931-63031953 CAGATGCTGAAGGACCTGGTAGG + Intergenic
956499292 3:69864695-69864717 CAGACCATGAAGGATCTGGTAGG - Intronic
956566274 3:70641984-70642006 ATGATCATGGTGGACATGGTTGG - Intergenic
956643119 3:71432990-71433012 CTGATCATTTTGTACCTGCTTGG + Intronic
957849449 3:85787799-85787821 CAGATCATGCAGGACTTGTTAGG - Intronic
959208945 3:103351063-103351085 CAGATCATGTAGGATCTTTTAGG + Intergenic
965216024 3:165865896-165865918 CTTATCATGTAGGACTTTCTAGG + Intergenic
965606344 3:170501213-170501235 CTGATCCTGGAGTACCTGATTGG - Exonic
965824264 3:172714707-172714729 CAGATCATTTAGGACCATGTAGG + Intergenic
966351327 3:179035229-179035251 CAGATCATGTAGGGCCTTATAGG - Intronic
967811385 3:193763999-193764021 CAAGTCATGTAGGACCTGGTGGG - Intergenic
970498984 4:16657569-16657591 CAGATAATGTAGGGCCTTGTAGG - Intronic
971024215 4:22571903-22571925 CTGATCATCTGGGATCTGCTGGG - Intergenic
971467317 4:26977310-26977332 CAGATCTCATAGGACCTGGTAGG + Intronic
971778635 4:31001720-31001742 CTGATTATGTAGAAGCTGTTTGG + Intronic
972154809 4:36146413-36146435 CTGATCATGTAGGGCCTTATCGG - Intronic
974010092 4:56598733-56598755 CAGATCATGTAGGGCCTTGTAGG + Intronic
974374663 4:61061001-61061023 CTGATCATATATGCCCTGGGAGG + Intergenic
975854451 4:78608409-78608431 CAGATCATGCAGGACCTTTTTGG + Intronic
976823059 4:89228741-89228763 TTGACCATGTAGGACAAGGTTGG + Intergenic
978561112 4:110034460-110034482 CTGATCACATAGCACCTGGGGGG - Intergenic
980091441 4:128447306-128447328 CAGATCATGTTGGACCTTCTAGG + Intergenic
980478428 4:133352048-133352070 CTAATTATGTAGGACCTAGGAGG - Intergenic
981198551 4:141949803-141949825 CTCAGCATGTAGGGCCTGGTGGG + Intergenic
981301933 4:143196963-143196985 ATGATAATGTAGGACCAGGGTGG - Intronic
981702296 4:147619934-147619956 CAGATCATGTTGGACCTTGATGG - Intronic
982862061 4:160464456-160464478 CTGATAATGTAGGTCCAGCTGGG + Intergenic
986040084 5:3985284-3985306 CTGATTTACTAGGACCTGGTGGG + Intergenic
987246943 5:16058749-16058771 TAGATCACGTAGGACCTTGTGGG + Intergenic
994139524 5:96326296-96326318 CTTGTCATGGAGGACCTTGTAGG - Intergenic
997448797 5:133965038-133965060 CAGATCATGTAGGATCTTGAAGG - Intronic
997624001 5:135319406-135319428 CTGATCATGTTGGGTCTTGTGGG + Intronic
997958890 5:138303413-138303435 CAGATCGTGTAGGGCCTTGTAGG - Intronic
998692627 5:144604021-144604043 CAGATCAAGTAGGACCTTGCAGG + Intergenic
999411270 5:151351936-151351958 TGGATCATGCAGGACCTTGTGGG - Intergenic
999559162 5:152781166-152781188 CAGATCATGTAGGGCCTTGCAGG - Intergenic
999855833 5:155592842-155592864 TTGGTTATGTAGGACCTGGCAGG - Intergenic
999861393 5:155650687-155650709 CAGATCATGTAAGAACTTGTGGG + Intergenic
1002169143 5:177365828-177365850 CTGACCAAGTAGAACCTGGCCGG + Intronic
1003654825 6:7996875-7996897 CTAATTATGTAGGACCTTGAAGG - Intronic
1005136961 6:22580272-22580294 CTGATCCTGTAGGACCAGGATGG + Intergenic
1007374666 6:41448314-41448336 CAGAGCATGTAAGACCTGGCAGG - Intergenic
1008775764 6:55035719-55035741 CAGATCATGTAGGACCCCGTAGG - Intergenic
1009338624 6:62526034-62526056 GTGATAATGTAGGTCCTTGTTGG - Intergenic
1009430749 6:63563271-63563293 TGGATCACGTAGGACCTTGTAGG - Intronic
1009696035 6:67104351-67104373 CTGTTCCTGAAGGACCTTGTAGG - Intergenic
1012188126 6:96247298-96247320 CAGATCATGTAGGACTTTGTAGG + Intergenic
1012783456 6:103592231-103592253 CAGATCATGTATGGCCTTGTAGG - Intergenic
1013485678 6:110594028-110594050 GTGTTCAGGGAGGACCTGGTAGG + Intergenic
1016492007 6:144615898-144615920 CTGATCATGTAGGACCTGGTAGG - Intronic
1018871480 6:167786925-167786947 CTCATCATTTAGGACGTGGTTGG + Intronic
1018963089 6:168462520-168462542 TTGGTCATGTGGGACCTGCTGGG - Intronic
1021168505 7:17369781-17369803 CTGATTCTGTAGGTCCGGGTAGG + Intergenic
1022312573 7:29210948-29210970 CGGATCATGGAGGGCCTCGTAGG + Intronic
1023704719 7:42929730-42929752 CTAATCGTGTAGGACTTTGTAGG - Intronic
1024639507 7:51317357-51317379 CTGATTCCGTGGGACCTGGTGGG - Intergenic
1025213091 7:57032447-57032469 CTGATCTTGGTGGACCTGGCAGG - Intergenic
1025658861 7:63544377-63544399 CTGATCTTGGTGGACCTGGCAGG + Intergenic
1026241768 7:68581716-68581738 CAGATCATGTAGGGTCTTGTAGG - Intergenic
1026375526 7:69746721-69746743 CAGGTCATATAGGACCTTGTAGG + Intronic
1029676215 7:102070825-102070847 CTGATCTTGGATGACCTGGCAGG - Intronic
1030487526 7:110189091-110189113 CAGATCATGCAGGACTTTGTAGG + Intergenic
1030740258 7:113101092-113101114 CAGATCATGTAGGTCATGGCAGG - Intergenic
1031710518 7:125040385-125040407 CTGAACATCTGGGACTTGGTTGG - Intergenic
1033546037 7:142400813-142400835 CTAATGATATAGGACCTCGTGGG - Intergenic
1036125428 8:6057639-6057661 CAGATTAGGAAGGACCTGGTAGG - Intergenic
1036598534 8:10238051-10238073 CAGATAGTGTAGGACCTTGTGGG - Intronic
1036691683 8:10948536-10948558 CAGACCTTGTAGGGCCTGGTCGG + Intronic
1038969724 8:32619409-32619431 CTGAGCATGTAGTGCCTTGTAGG + Intronic
1041031614 8:53742093-53742115 CTGATCGTGTAGGGCCTTGTAGG - Intronic
1041189857 8:55342503-55342525 CTGATCACATAGGGCATGGTGGG - Intronic
1041364044 8:57082948-57082970 CTGCTCCTGCAGGACCTGGGAGG + Intergenic
1043551192 8:81374953-81374975 CAGATCCTGTAGGACTTTGTGGG + Intergenic
1045372019 8:101533907-101533929 ATGATCCTGGGGGACCTGGTAGG + Intronic
1045890096 8:107145793-107145815 CTGATGATATAAGACCTGGTAGG + Intergenic
1046758457 8:117995497-117995519 CTGAAAATGAAGGACGTGGTTGG + Intronic
1046814417 8:118568383-118568405 CAGATCATGCAGGATCTGGTAGG + Intronic
1047701883 8:127457029-127457051 CAGATCATGTAAGGCCTGATTGG - Intergenic
1048476888 8:134751660-134751682 CAGATCAAGTAGCACCAGGTGGG + Intergenic
1048904019 8:139069479-139069501 CGGATCACTCAGGACCTGGTAGG + Intergenic
1055392530 9:75838390-75838412 CAGATCATGGAGAACCTGGTGGG - Intergenic
1055653411 9:78430365-78430387 CTGACCATGTAGGCACAGGTGGG + Intergenic
1056736641 9:89215429-89215451 CTGTTTATGCAGGACCTTGTGGG - Intergenic
1056822594 9:89854058-89854080 CTGTGCTTGTAGGACCTGGAAGG + Intergenic
1057119637 9:92559475-92559497 CTGCTCCTGCAGGACCTGGGAGG - Intronic
1058026966 9:100151566-100151588 CTGATCCTGTAGGGCCTTATAGG + Intronic
1059866794 9:118523285-118523307 CAGGTCAAGTAGGACCTGGTAGG - Intergenic
1060463655 9:123882931-123882953 CAGATCATGTAGGACTTTGTAGG - Intronic
1187392310 X:18894199-18894221 CTGTTCTTGCAGGACCAGGTGGG - Exonic
1187544120 X:20230622-20230644 CTTATTATGCAGGGCCTGGTAGG + Intronic
1188330446 X:28864750-28864772 GTGATCATTTAGGGCCTCGTGGG + Intronic
1189029271 X:37433224-37433246 CTGATTGTGTAGTACCTGGTGGG - Intronic
1189537986 X:41956206-41956228 CAGATCATGTAGGGCCTTGTAGG - Intergenic
1190302561 X:49065167-49065189 CTGATCATGCAGGATGTGGTCGG - Intronic
1190489342 X:50965394-50965416 CAGATCATGTAGGATTTTGTAGG - Intergenic
1192069200 X:67918766-67918788 CTGTTCCTGCAGGACCTGGGAGG - Intergenic
1192273832 X:69610180-69610202 CAGATCATGTAGGGCCTTGTAGG + Intergenic
1192280119 X:69676116-69676138 CAGATCATGTAGGGCTTTGTAGG + Intronic
1193624707 X:83803842-83803864 TAGATCATGTAGGGCCTTGTAGG + Intergenic
1194423601 X:93708314-93708336 CAGATCATATAGGACCTTATAGG + Intronic
1194713699 X:97265761-97265783 CAAATCATGTAGGTCCTTGTTGG + Intronic
1195077764 X:101343788-101343810 CTGATTATGTGGGGCCTTGTAGG - Intergenic
1195408582 X:104544271-104544293 CAGATCATAAAGGACCTTGTGGG - Intergenic
1195691047 X:107625970-107625992 CTGATCATGCAGAACCTTATAGG - Intergenic
1196764657 X:119231952-119231974 CAGATCCTGTAGGGCCTTGTAGG + Intergenic
1197741707 X:129900057-129900079 CAGATCATGTAGGGCCTTGTAGG - Intergenic
1197881749 X:131173841-131173863 CAGATCATGTAGGGCCTTTTAGG + Intergenic
1198318742 X:135497330-135497352 CCGTTCATGTAGGACTTTGTAGG - Intergenic
1198320441 X:135514398-135514420 CAGATCATGCAGGGCCTAGTTGG - Intergenic
1198380840 X:136081973-136081995 CAGATCATGTAAGGCCTTGTAGG - Intergenic
1198710430 X:139495661-139495683 CAGATCATGGAGGTCCTTGTAGG - Intergenic
1198789394 X:140327128-140327150 CAGATCATGAAGGGCCTCGTGGG + Intergenic
1199778274 X:151034728-151034750 CAGATCCTATAGGACCTTGTGGG - Intergenic