ID: 1016493548

View in Genome Browser
Species Human (GRCh38)
Location 6:144633973-144633995
Sequence GCAGCTAGACATTTAAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 141}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016493548_1016493551 17 Left 1016493548 6:144633973-144633995 CCTGCTTTTAAATGTCTAGCTGC 0: 1
1: 0
2: 1
3: 12
4: 141
Right 1016493551 6:144634013-144634035 CCCAACCTGGCAGTCAGAACAGG No data
1016493548_1016493555 27 Left 1016493548 6:144633973-144633995 CCTGCTTTTAAATGTCTAGCTGC 0: 1
1: 0
2: 1
3: 12
4: 141
Right 1016493555 6:144634023-144634045 CAGTCAGAACAGGCTGCCCAGGG 0: 1
1: 0
2: 2
3: 29
4: 237
1016493548_1016493554 26 Left 1016493548 6:144633973-144633995 CCTGCTTTTAAATGTCTAGCTGC 0: 1
1: 0
2: 1
3: 12
4: 141
Right 1016493554 6:144634022-144634044 GCAGTCAGAACAGGCTGCCCAGG 0: 1
1: 0
2: 1
3: 35
4: 260
1016493548_1016493549 4 Left 1016493548 6:144633973-144633995 CCTGCTTTTAAATGTCTAGCTGC 0: 1
1: 0
2: 1
3: 12
4: 141
Right 1016493549 6:144634000-144634022 CTGAGCAAAAAAGCCCAACCTGG 0: 1
1: 0
2: 0
3: 16
4: 203
1016493548_1016493556 28 Left 1016493548 6:144633973-144633995 CCTGCTTTTAAATGTCTAGCTGC 0: 1
1: 0
2: 1
3: 12
4: 141
Right 1016493556 6:144634024-144634046 AGTCAGAACAGGCTGCCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016493548 Original CRISPR GCAGCTAGACATTTAAAAGC AGG (reversed) Intronic
902957729 1:19937415-19937437 GCAGATAAAGATTTAAAAGAAGG - Intergenic
905506714 1:38485548-38485570 GAAGGGAGACATTTAAAAGGTGG + Intergenic
907857572 1:58318769-58318791 TCACCTCGAAATTTAAAAGCTGG + Intronic
908943188 1:69461929-69461951 ACAGCTAGACATTTAATTTCTGG + Intergenic
911138669 1:94472210-94472232 GCAGCTATAAATTTAAAAAATGG - Intronic
911342229 1:96652886-96652908 GCAGGTAAACATTCAAAATCAGG + Intergenic
916303918 1:163307177-163307199 GCAGCTAGAGATCTAAGGGCAGG - Intronic
917970498 1:180203106-180203128 AAAGCTACATATTTAAAAGCTGG + Exonic
918757215 1:188354111-188354133 GCAGTCAGAAATGTAAAAGCAGG + Intergenic
918930952 1:190856348-190856370 GCAGCAAGACATTCAAAATGTGG + Intergenic
922699367 1:227749611-227749633 GCAGCCTGACACTGAAAAGCGGG - Intronic
923357588 1:233175751-233175773 GCAGAGATACATTTAAAAGCAGG - Intronic
923925489 1:238622207-238622229 GCAGCTAGATCTTCAAAACCTGG - Intergenic
924042464 1:239997649-239997671 GGAGCAAGACATTTAAACCCGGG + Intergenic
1065293869 10:24256921-24256943 GCTGCTAGCCATTTATATGCAGG + Intronic
1066782986 10:38972707-38972729 GGAGCTTAACATCTAAAAGCAGG + Intergenic
1068145798 10:53069144-53069166 GCAGTTTGACATTTAATTGCTGG + Intergenic
1074332940 10:112537808-112537830 GCAGATAGAAATTTTAAAACAGG - Intronic
1075508719 10:123051115-123051137 GCTGCTAGGCTTTTAGAAGCTGG + Exonic
1079698730 11:23517871-23517893 CTAGCTAGAAATTTAAAAGTGGG - Intergenic
1080519759 11:33058017-33058039 GGCGCTAGACATTTCCAAGCTGG + Exonic
1080738348 11:35039592-35039614 GCAGCAAGAGATTTAAATGTGGG - Intergenic
1080859725 11:36142735-36142757 GCAGCCAGGCATTTTCAAGCAGG + Intronic
1095331898 12:40976289-40976311 GTATCTAGGCATTTAAAATCAGG + Intronic
1101769296 12:107733688-107733710 GCAGCTAGTAAGTTTAAAGCAGG - Exonic
1103312055 12:120018206-120018228 GCATCTAGATTTTTAAAAGCAGG + Intronic
1106595818 13:31135470-31135492 GCAGCTAGAAATTATAAAGTAGG + Exonic
1107400447 13:40064063-40064085 CTAGTTAGACATTTAAAGGCAGG - Intergenic
1110741106 13:78998204-78998226 ATAGCTACACATTTAAAAGATGG - Intergenic
1110815202 13:79853254-79853276 GCTGCTAGACATTCAAAGGGAGG + Intergenic
1112037453 13:95509915-95509937 GCTGGTAAACATTTAAAAGGTGG + Intronic
1113982275 13:114286500-114286522 GGATCTAGACATTAAAAAGTAGG - Exonic
1114064039 14:19045122-19045144 GTATCTAGACACTTAAGAGCAGG + Intergenic
1114098220 14:19354874-19354896 GTATCTAGACACTTAAGAGCAGG - Intergenic
1116752921 14:48909676-48909698 GCAGGAAGATTTTTAAAAGCTGG + Intergenic
1119985370 14:79131530-79131552 GCAGCTAGAGATCTGAAAACGGG - Intronic
1120273237 14:82341053-82341075 GAAGCTAGATATTAGAAAGCAGG + Intergenic
1122830141 14:104391961-104391983 GCAGCTTGACATTTACAAAAAGG - Intergenic
1123492570 15:20794092-20794114 GTATCTAGACACTTAAGAGCAGG - Intergenic
1123549072 15:21363184-21363206 GTATCTAGACACTTAAGAGCAGG - Intergenic
1128082378 15:64864326-64864348 GCAGCTGGACAGGCAAAAGCTGG + Intronic
1130154767 15:81340651-81340673 GCTGCTAGACATGTAAAATGGGG + Intronic
1130166351 15:81463355-81463377 ACAGCTATACATCTAAAAACTGG - Intergenic
1130193000 15:81754239-81754261 GCAGCTACACATTCAAAACAGGG - Intergenic
1132328374 15:100991786-100991808 ACACCAAGACATTTAAAATCAGG - Intronic
1202957406 15_KI270727v1_random:90406-90428 GTATCTAGACACTTAAGAGCAGG - Intergenic
1135375914 16:21947332-21947354 GCAGCTAGAATTTGAAGAGCAGG + Intergenic
1135493725 16:22933150-22933172 GAAGCTAGCCATTCAAAAGCCGG + Intergenic
1136704008 16:32170955-32170977 GCAAAAAGACATTTAAAAGAAGG + Intergenic
1136763901 16:32758451-32758473 GCAAAAAGACATTTAAAAGAAGG - Intergenic
1136804198 16:33111935-33111957 GCAAAAAGACATTTAAAAGAAGG + Intergenic
1137303422 16:47176583-47176605 GCAGCTAGAAAATTAGAAACAGG - Intronic
1137795394 16:51213163-51213185 ACAACTAGACATGTTAAAGCTGG + Intergenic
1138132894 16:54496996-54497018 GCAGGAACACATTAAAAAGCTGG + Intergenic
1203066048 16_KI270728v1_random:1018773-1018795 GCAAAAAGACATTTAAAAGAAGG - Intergenic
1144564436 17:16348456-16348478 TCAGGTTGACATTTAAAAGGTGG - Intronic
1146340957 17:32019734-32019756 GAAGCTAGACTTCTTAAAGCTGG - Intronic
1146780460 17:35666655-35666677 GTATCTAGACATTTAAGATCAGG + Intronic
1147897324 17:43759086-43759108 GGAGACAGACAATTAAAAGCCGG - Intergenic
1150542203 17:66113506-66113528 TCAGCTCTACATTTACAAGCAGG + Intronic
1151529884 17:74697374-74697396 GCATCTAGACTTTTGAAACCAGG - Intronic
1153288002 18:3474218-3474240 CCATCTAGACCTTTAATAGCTGG + Intergenic
1154450115 18:14468630-14468652 GTATCTAGACACTTAAGAGCAGG - Intergenic
1156859401 18:41818526-41818548 ACAGCTAGAGAGTTTAAAGCAGG - Intergenic
1158338824 18:56443670-56443692 GAAGCAAGTCATTTAAAGGCAGG + Intergenic
1159422263 18:68237306-68237328 GCATCCAGACAGTTATAAGCTGG - Intergenic
1163304153 19:16467093-16467115 GGACCTAAACATTGAAAAGCAGG + Intronic
1164627635 19:29739959-29739981 CCAGATTGACTTTTAAAAGCAGG + Intergenic
1165356086 19:35304996-35305018 GCAGCCAGAGGTTTAACAGCTGG - Intronic
925594698 2:5543822-5543844 GCAGCAAAACATTCAAAAGCTGG + Intergenic
926849159 2:17175669-17175691 ACACCTGGACATTTAAAAGTGGG - Intergenic
927078674 2:19605889-19605911 CCTGCTAGACATTTAATAGCAGG - Intergenic
928540163 2:32277273-32277295 GTATGTAAACATTTAAAAGCAGG + Intergenic
931251945 2:60539509-60539531 GCAGCTGGCCAGTAAAAAGCAGG + Intronic
931975838 2:67643336-67643358 GCATTTAGACTTTTAAAAGCAGG + Intergenic
932068770 2:68594826-68594848 GCAGGAAGACATTTCAAGGCAGG - Intronic
932639742 2:73432270-73432292 GCTCCTAAACATTTAAAAGCAGG + Exonic
933108310 2:78361600-78361622 GCAGGTAGAGATTGAAAAGAGGG - Intergenic
937971858 2:127556005-127556027 GCAGCAACACAATTAATAGCCGG - Intronic
938481299 2:131664106-131664128 GTATCTAGACACTTAAGAGCAGG + Intergenic
939818725 2:146929568-146929590 GCAGCAAGCCTTTTAAAAACTGG + Intergenic
945710687 2:213290600-213290622 GCAGCTTGACATTAAGAAACTGG + Intronic
945727858 2:213494925-213494947 TGAGCTAGACATGTAAAAACTGG - Intronic
945749114 2:213757993-213758015 ACAGCTAGACATTAAAAAGTAGG + Intronic
947091854 2:226520997-226521019 ACAGCCAGACTTTTGAAAGCTGG + Intergenic
1169837517 20:9896896-9896918 GGAGTTACACATTTCAAAGCAGG + Intergenic
1170290506 20:14763806-14763828 GCAGCTGTACATCTAAAACCCGG + Intronic
1173896202 20:46552554-46552576 GCAGCCAGACAGCTAACAGCAGG - Intergenic
1176446071 21:6821732-6821754 GTATCTAGACACTTAAGAGCAGG + Intergenic
1176824237 21:13686765-13686787 GTATCTAGACACTTAAGAGCAGG + Intergenic
1178719103 21:34992378-34992400 GCAGCCAGACTTTGGAAAGCAGG + Intronic
1180482531 22:15767756-15767778 GTATCTAGACACTTAAGAGCAGG + Intergenic
958847851 3:99286811-99286833 GAAGATATACATTTAAAAGAGGG + Intergenic
959107168 3:102077656-102077678 ACAGCAAGTCATTTTAAAGCAGG - Intergenic
963078900 3:141372977-141372999 GCAGCTAGAAATTAGAAATCAGG - Intronic
964008518 3:151861097-151861119 AAAGCTAGAATTTTAAAAGCTGG - Intergenic
964134499 3:153329379-153329401 GCAGAGAGACATTTCTAAGCAGG + Intergenic
966208664 3:177430279-177430301 GGAGCAAGACTTTTAAAAACAGG + Intergenic
968025251 3:195436983-195437005 TCATATAGAAATTTAAAAGCTGG - Intronic
971560584 4:28075136-28075158 TCAGCTAGTAATTTAAAACCTGG - Intergenic
975618208 4:76268837-76268859 TGAGCTTGACATTTAAAAGTAGG - Intronic
978644780 4:110917008-110917030 GCAGCTAGTCAATTAGAAGGGGG + Intergenic
979407141 4:120327435-120327457 GTAGCAAGTCATTTAACAGCTGG + Intergenic
979792721 4:124806361-124806383 GAAGCTTCACATTTAAAACCAGG - Intergenic
981621820 4:146709284-146709306 GCAGCCAAACAGTTAAATGCAGG - Intronic
983008308 4:162513329-162513351 GGAGCTACACATTTACAAGAAGG + Intergenic
983754551 4:171318950-171318972 GCAGCTGGGGTTTTAAAAGCTGG - Intergenic
983887380 4:172995450-172995472 GCGTCAAGATATTTAAAAGCAGG - Intronic
985608785 5:874255-874277 GCAGCTAGAATTTTAAGAGCTGG - Intronic
989201403 5:38768099-38768121 ACAGCTCGACCTTTAAAAGCTGG + Intergenic
989408105 5:41084251-41084273 GCAGCTAAACAATTCAAAGGAGG + Intergenic
991329968 5:65483261-65483283 GAAGCTTGATATTTAAGAGCTGG - Intergenic
993192333 5:84698363-84698385 ACAGCAAAACATTAAAAAGCAGG + Intergenic
993385209 5:87254131-87254153 TCAGCTATGCATTTAAAAGTAGG - Intergenic
1001305562 5:170569949-170569971 GCATCTAGACATTTGATATCTGG + Intronic
1003351730 6:5324157-5324179 GCAGCTTGACAGTTAAAGACCGG - Intronic
1006234724 6:32618895-32618917 GCATCTGGAAATTTAGAAGCTGG + Intergenic
1010361855 6:75004354-75004376 GCAGCTGGACATCTGAGAGCGGG + Intergenic
1011800099 6:91003239-91003261 GCACCTAGAAATGTAAATGCTGG + Intergenic
1013063421 6:106660035-106660057 GCAGCTAGAATTTGCAAAGCAGG - Intronic
1015118877 6:129679834-129679856 GAGACTAGAAATTTAAAAGCAGG + Intronic
1015697175 6:135993512-135993534 GCAGCAAGACTGTTATAAGCTGG + Intronic
1016493548 6:144633973-144633995 GCAGCTAGACATTTAAAAGCAGG - Intronic
1017030426 6:150216185-150216207 TCAGCAAGACATTCAAAACCTGG + Intronic
1019110502 6:169706917-169706939 GCAGTGAGACATTTCAAAGCTGG - Intronic
1019931421 7:4225873-4225895 GCTGCTCAACATTCAAAAGCAGG + Intronic
1021089764 7:16469632-16469654 GCAGCTTGATTTGTAAAAGCTGG + Intronic
1022240764 7:28510524-28510546 GCAGCTAGAAGTTTTAAAGGTGG - Intronic
1022665074 7:32403078-32403100 GCAGCTGATGATTTAAAAGCTGG - Intergenic
1023161083 7:37296412-37296434 TCAGATAGACTTTTAAAAGAAGG - Intronic
1027855944 7:83511480-83511502 GCAGCTAAACATTTCTAAGTGGG + Intronic
1029685496 7:102144737-102144759 GCAACTAGAAATTTCAAAACTGG - Intronic
1030491963 7:110248205-110248227 GCTGGTAAACATTTAATAGCAGG + Intergenic
1030929725 7:115507238-115507260 GAAGCTAGACTTTTTAAATCAGG - Intergenic
1031167111 7:118242017-118242039 GAGGGTAGACATTTAAAACCAGG + Intronic
1035876437 8:3194949-3194971 GCCAATAGACATTTACAAGCTGG + Intronic
1038599987 8:28930447-28930469 GCTGCTAGATATTTATAACCTGG + Intronic
1039889452 8:41674178-41674200 GGAGCTAGTGATGTAAAAGCAGG - Intronic
1042190322 8:66179060-66179082 GCAGATAGACGTTTAAAAGCTGG - Intergenic
1043263691 8:78234847-78234869 GCAGTTACACAGATAAAAGCTGG - Intergenic
1043807668 8:84693018-84693040 GAAGTTAGACATTTAAAATAAGG - Intronic
1048169170 8:132088940-132088962 GCAGCTACTGTTTTAAAAGCAGG - Intronic
1049418647 8:142507020-142507042 GCAGCCAGACACATAAAAACTGG + Intronic
1049418872 8:142508049-142508071 GCAGCCAGACACATAAAAACTGG - Intronic
1049626782 8:143626984-143627006 GAAGCTAGACGTTCAAAATCAGG - Intergenic
1053001801 9:34580721-34580743 GCAGCTAGGCTTTAAAAAGATGG - Intronic
1057026197 9:91735531-91735553 GCAGCTAGCATTTTAAAAGATGG + Intronic
1058842822 9:108926387-108926409 GCTAATAGACATTTAATAGCTGG + Intronic
1060753971 9:126196612-126196634 CAAGGCAGACATTTAAAAGCTGG - Intergenic
1203523122 Un_GL000213v1:62793-62815 GTATCTAGACACTTAAGAGCAGG - Intergenic
1187841866 X:23497242-23497264 GAAACTAGACATTTCAAACCTGG + Intergenic
1191142406 X:57130512-57130534 TCAGCTATACATTTAAAAGGAGG + Intergenic
1192574311 X:72230548-72230570 GCAGCTCAACAGTTAAAGGCAGG - Intronic
1197490827 X:127115477-127115499 TCAGGTAGTCATTCAAAAGCAGG - Intergenic
1198993814 X:142548970-142548992 GCATCTAGACATTTCAGAGATGG - Intergenic