ID: 1016499708

View in Genome Browser
Species Human (GRCh38)
Location 6:144705618-144705640
Sequence ACTCCCATAGTGATGGTATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3076
Summary {0: 1, 1: 6, 2: 138, 3: 705, 4: 2226}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016499708_1016499712 2 Left 1016499708 6:144705618-144705640 CCCAATACCATCACTATGGGAGT 0: 1
1: 6
2: 138
3: 705
4: 2226
Right 1016499712 6:144705643-144705665 GGATTTCAACCTGTAAATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016499708 Original CRISPR ACTCCCATAGTGATGGTATT GGG (reversed) Intronic
Too many off-targets to display for this crispr