ID: 1016499708 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:144705618-144705640 |
| Sequence | ACTCCCATAGTGATGGTATT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 3076 | |||
| Summary | {0: 1, 1: 6, 2: 138, 3: 705, 4: 2226} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1016499708_1016499712 | 2 | Left | 1016499708 | 6:144705618-144705640 | CCCAATACCATCACTATGGGAGT | 0: 1 1: 6 2: 138 3: 705 4: 2226 |
||
| Right | 1016499712 | 6:144705643-144705665 | GGATTTCAACCTGTAAATTTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1016499708 | Original CRISPR | ACTCCCATAGTGATGGTATT GGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||