ID: 1016502751

View in Genome Browser
Species Human (GRCh38)
Location 6:144740471-144740493
Sequence AAGTATAAGTAATTGCTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 287}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016502751 Original CRISPR AAGTATAAGTAATTGCTTTC AGG Intronic
901353052 1:8615336-8615358 AAAAATAAGTAATGTCTTTCTGG - Intronic
903801177 1:25969519-25969541 AAATTTAAGTAATTTCTTTAAGG - Intronic
908599268 1:65721656-65721678 AAGTTTTAGGAAATGCTTTCGGG + Intergenic
909379221 1:74978342-74978364 AAGTAAAAGTAAATCCTCTCTGG + Intergenic
909500821 1:76333307-76333329 CAGTATAAGTAATAACTTTCTGG + Intronic
909869795 1:80724989-80725011 AATTTTAAGTACTTCCTTTCTGG - Intergenic
910513386 1:88031436-88031458 AAGTTTAGGTTATGGCTTTCAGG - Intergenic
911096404 1:94058660-94058682 AAGGATAAGAAATTGATTTCAGG - Intronic
911336093 1:96582133-96582155 GAGTATGAGTAATTCCTTCCTGG - Intergenic
911438222 1:97890142-97890164 AAGGATAAGTGATTTCTTTTTGG + Intronic
912189421 1:107320325-107320347 AAGTGTAAGTAATTATTTTGTGG - Intronic
912202835 1:107477661-107477683 TAGTATAAATAATTACTTTTGGG - Intronic
912922309 1:113881165-113881187 CAGTCAAAGGAATTGCTTTCAGG + Intronic
913235684 1:116780718-116780740 AACTATTAATAATTGTTTTCTGG - Intergenic
917686999 1:177426561-177426583 AAGTAGAAGCATTTGCATTCTGG - Intergenic
918205339 1:182303359-182303381 GAGTATCAGTAATTGCCTGCTGG - Intergenic
919032283 1:192257919-192257941 AAGCATAAGAAAATTCTTTCTGG - Intergenic
921692615 1:218167350-218167372 AACTATAAGTAACTTCATTCAGG - Intergenic
922435539 1:225601581-225601603 AAGTGTAGGTCATTGCTTTTAGG - Intronic
923358556 1:233184702-233184724 AAGGATAACTAATAGCTTTGGGG + Intronic
1067267473 10:44757882-44757904 AAGGACAAGGAATTGTTTTCAGG - Intergenic
1068918976 10:62463395-62463417 AAGTTTTAGTAATTGCCCTCTGG + Intronic
1069658022 10:70104813-70104835 AAGGAAATGTAATTTCTTTCTGG + Intronic
1071252143 10:83829881-83829903 AGGCAGAAGTAATTGCATTCAGG - Intergenic
1071587409 10:86837777-86837799 AAGCATTACTAATTGCATTCAGG + Intronic
1071995030 10:91139295-91139317 AGGAATAAGTTGTTGCTTTCGGG + Intergenic
1073366474 10:102946441-102946463 TAGTATCACTAATTGCTTTTAGG - Intronic
1074858837 10:117494025-117494047 CAGTATTAGCATTTGCTTTCAGG - Intergenic
1075110794 10:119580858-119580880 AATTAAAAGTAATAGCATTCTGG - Intronic
1075259657 10:120951642-120951664 AAGTGCAAGTTATTGCTTTCTGG + Intergenic
1075758900 10:124840170-124840192 AACAGTAAGTAACTGCTTTCTGG + Intergenic
1076206975 10:128611356-128611378 AAGTATAAGTAATGACTTGCAGG - Intergenic
1079212932 11:18479383-18479405 ATGTATACGTAATTGCCATCTGG + Exonic
1079542382 11:21592016-21592038 AGGTATAAATAAGTGCATTCAGG + Intergenic
1081308608 11:41544148-41544170 ATGTATAAGAAATTGCTTTATGG + Intergenic
1081453503 11:43197160-43197182 AAGTTTATGTAATTGCCTTTAGG + Intergenic
1082170247 11:48995386-48995408 AAATATAAGTTATTGTTTTAAGG + Intergenic
1082672338 11:56050052-56050074 CAGTTTAAGAAATTGTTTTCTGG - Intergenic
1084294237 11:68200369-68200391 AAATAAAAGTATTTGCTTACTGG - Intronic
1085182425 11:74546945-74546967 AAGCTTAAGTTATTGCTGTCAGG + Intronic
1085584068 11:77684231-77684253 GTGTATAAGTAATTTCATTCCGG - Intronic
1086163013 11:83744439-83744461 AATTATAAGGTATTGCTTTTTGG + Intronic
1086846694 11:91758612-91758634 AATTATATATTATTGCTTTCTGG + Intergenic
1087079550 11:94156637-94156659 AAGTAAAAATAAATCCTTTCTGG + Intronic
1087192529 11:95270100-95270122 TATAATAAGTAATTGATTTCTGG + Intergenic
1088109297 11:106243942-106243964 AAATAAAAGTCATTTCTTTCAGG + Intergenic
1089841259 11:121419872-121419894 AAGTATAAAAAATTGATTTTGGG + Intergenic
1091607214 12:1964448-1964470 TAGTTTAATTAATTGCTTTTGGG + Intronic
1092269110 12:7008129-7008151 AAGGATAAGTAATTAATTTCTGG - Intronic
1092969440 12:13677990-13678012 ATGCATAAGTTATTGCTGTCAGG - Intronic
1093740581 12:22680858-22680880 GAGTATACGTAATGGCTTTGTGG + Intronic
1093820129 12:23605202-23605224 AAGAATAAGTAATGGCTTAGTGG - Intronic
1094347794 12:29489874-29489896 ATGTAGAAGTAATTGTTTTTAGG + Intronic
1097771056 12:63585654-63585676 AAGTATCAGTAGTTACTTTCAGG - Intronic
1098175735 12:67788840-67788862 TAGTATAAGAAACTGCTTTGAGG + Intergenic
1099126198 12:78761284-78761306 AAATAAAAATAATTGCATTCTGG - Intergenic
1099995944 12:89778633-89778655 AAATTTAAGTACTTGCTTTAGGG - Intergenic
1102448895 12:113025770-113025792 AAGTATAAGAACTTACTTCCAGG + Intergenic
1102702762 12:114854094-114854116 GAGTAGAAGTATTTGCTGTCAGG + Intergenic
1103366531 12:120388144-120388166 AAGGAGAAGTAATTGCTTACTGG + Intergenic
1106358889 13:29011818-29011840 CAGTTTATTTAATTGCTTTCTGG + Intronic
1106939522 13:34762740-34762762 AAATGTAAGTAAATCCTTTCAGG + Intergenic
1107040296 13:35940793-35940815 AAGCAGTAGTAATCGCTTTCTGG + Intronic
1108676599 13:52742475-52742497 AAATGTAAGTATATGCTTTCTGG + Intergenic
1108881147 13:55117926-55117948 AAGTGAAAGTATTTTCTTTCAGG - Intergenic
1108886841 13:55196595-55196617 AAGCTTAAGTAATTGATTTCAGG + Intergenic
1110930904 13:81215563-81215585 AAGTATAAATAATTTATTTGTGG + Intergenic
1111334014 13:86797919-86797941 AAGTATAAAAAATAGCTTTTAGG - Intergenic
1113496625 13:110735452-110735474 AAGGATAAATAAATGCTTCCAGG - Intergenic
1113570428 13:111350408-111350430 AAGTACAAGTCATTTTTTTCAGG + Intergenic
1114710749 14:24775487-24775509 AAGTCTGAGTCTTTGCTTTCTGG - Intergenic
1114904118 14:27103269-27103291 AAGTATAATACATTGCTTTATGG - Intergenic
1115272425 14:31568816-31568838 AAGTAAAATGAATTGCTTCCTGG - Intronic
1115506860 14:34101315-34101337 AAGTATAAGTATTTGTTTTATGG + Intronic
1115602148 14:34965719-34965741 GGGTATAAGTAATTGCATTCTGG + Intergenic
1115667179 14:35563538-35563560 AGGTAAAAATAATTGCTTCCAGG + Intronic
1116207338 14:41884871-41884893 ATGTTTAAGTTATTGCTATCAGG + Intronic
1118707082 14:68490472-68490494 AATTATAAGTGATTCGTTTCTGG + Intronic
1120063126 14:80008728-80008750 AAGTATTACTAATTGTTTTATGG - Intergenic
1124565616 15:30810701-30810723 AAATATAAGAAGTTGCCTTCAGG + Intergenic
1126200193 15:45976683-45976705 AAGTCTAAGTCATTGATTTGGGG + Intergenic
1127758446 15:62114815-62114837 AACTATCGTTAATTGCTTTCTGG + Intergenic
1130347543 15:83062449-83062471 AAGAATAAATTATTGCTTTTTGG + Intronic
1137630618 16:49941187-49941209 AACTAAAAGTAATTGCTAGCTGG + Intergenic
1138145460 16:54605189-54605211 AACTATATGGAGTTGCTTTCTGG - Intergenic
1141341665 16:83209417-83209439 ATGCATAAGTTATTGCTATCAGG + Intronic
1141382670 16:83589909-83589931 AAGGATAAGTGATTGTTTCCTGG + Intronic
1143677965 17:8450546-8450568 AAGCATAAGTAACTTCTCTCAGG + Intronic
1146540321 17:33687881-33687903 AATTATAGGTAATTGCTTTTGGG - Intronic
1147130122 17:38402733-38402755 AAAAATAAATAATTTCTTTCTGG + Exonic
1148657673 17:49299983-49300005 GAGTATCAGAAATTGCTTACAGG - Intronic
1149062779 17:52443064-52443086 AAATATAATTAATTGCTTTGTGG + Intergenic
1149227267 17:54488067-54488089 AAGTAAGAGTAATTGAGTTCTGG - Intergenic
1150118283 17:62575162-62575184 ATGTGTAAGCAATTGCTATCTGG + Intronic
1151709219 17:75791562-75791584 AAGTAGAACTAATTTCTTGCAGG + Intronic
1153367099 18:4269258-4269280 AAGTATAAATAATTTCTCTTTGG + Intronic
1153456753 18:5291396-5291418 AAGTTTGAGTATTTGCTTTATGG - Exonic
1155072979 18:22332404-22332426 AAATCTAAGTAATGGATTTCTGG + Intergenic
1155393772 18:25365039-25365061 AAGGAGAAGTTCTTGCTTTCAGG - Intergenic
1155708466 18:28846308-28846330 TAGTATACTTTATTGCTTTCTGG + Intergenic
1155755383 18:29488491-29488513 AAATATCTGTAATTGCTTTAGGG + Intergenic
1155871147 18:31029965-31029987 AAGAACAAGTAAGTGCTATCTGG - Intronic
1157762961 18:50277639-50277661 AAGTATAAGTAATTGATTTTGGG + Intronic
1158226834 18:55210115-55210137 AAGTATAAGTCAGTCATTTCTGG - Intergenic
1158479816 18:57811860-57811882 AATTATAAATAATAGCATTCTGG + Intergenic
1158946989 18:62455637-62455659 AAAAATAGGTAACTGCTTTCTGG + Intergenic
1159245836 18:65803559-65803581 ATGTATGAGTCATTTCTTTCTGG - Intronic
1159404009 18:67976865-67976887 AAGTAAAATTAATTGATTTCTGG - Intergenic
1159757743 18:72386703-72386725 AATTATAAGGAATTGAATTCTGG + Intergenic
1159760769 18:72422863-72422885 AATTATAATTTACTGCTTTCAGG + Intergenic
1163196491 19:15724924-15724946 AAGTTAAAAGAATTGCTTTCAGG - Intergenic
1163818880 19:19484887-19484909 AAGCATGAGGAATTGCTTTCTGG + Intronic
1164019974 19:21292537-21292559 AAGTTTAAGTAACTGCTTCAGGG + Exonic
1164166884 19:22687137-22687159 AAGTTTGAGTAATTGCTTCAGGG - Intergenic
928642309 2:33313225-33313247 AAGTATGAGTAATTCCTGTTGGG + Intronic
928959641 2:36910569-36910591 AATTCTTAGTAATTGCTTTAGGG - Intronic
929272567 2:39988664-39988686 AAGAAACAGTAATTGCTCTCAGG - Intergenic
929293793 2:40223539-40223561 AAGTATTAGTCATTGCTATTTGG + Intronic
929761884 2:44813940-44813962 ACGCATAAGTAATTGCATCCTGG - Intergenic
930344563 2:50163710-50163732 AAGAAAAAGTAAATGCTTACTGG - Intronic
930826506 2:55701220-55701242 AAGTATAAGAAATACATTTCTGG - Intergenic
933432843 2:82206566-82206588 AAAAATAGGTTATTGCTTTCTGG - Intergenic
935014769 2:99171313-99171335 AAGAAAGAGTAAGTGCTTTCAGG + Intronic
936174946 2:110211576-110211598 AAGAAGAAGTCATTTCTTTCCGG + Intergenic
938684924 2:133728998-133729020 ATGTTTAAGTTATTGCTATCAGG - Intergenic
939226241 2:139368450-139368472 AAGTATAAGTTGGTGCTTCCTGG - Intergenic
940136606 2:150443487-150443509 AAGTATAAGTATTTGCTGAATGG - Intergenic
941690364 2:168495006-168495028 ATGTTTAAGTTATTGCTGTCAGG + Intronic
943338378 2:186646361-186646383 AAGTTTAAGTGATTGGTTTAAGG + Intronic
943971783 2:194418782-194418804 AACTTTAAGTAATTGCTGTAAGG - Intergenic
944706951 2:202299346-202299368 AAGTATAATTTAGTGTTTTCTGG + Intronic
945489101 2:210433975-210433997 AAATATAACTAAATGCTTCCAGG - Exonic
946462779 2:219884354-219884376 AAGAAAAAGTCAGTGCTTTCTGG - Intergenic
947045907 2:225983447-225983469 AAGTTTAAGTTATTGATTTGGGG - Intergenic
1170285991 20:14709163-14709185 AAGTATAAAGAAATGCTTTGAGG - Intronic
1170410763 20:16088930-16088952 AAGTTTAAAAAATTGCTTTAAGG - Intergenic
1171398074 20:24852377-24852399 AAGTATATGTAATTGCTCAATGG + Intergenic
1171807641 20:29696948-29696970 AATTCTCAGAAATTGCTTTCTGG + Intergenic
1172889695 20:38255250-38255272 AGGTATAAATAAGTGCTTCCAGG + Intronic
1176687163 21:9860246-9860268 AGGTAGAAGTTATTGCTTTTAGG - Intergenic
1176992513 21:15515000-15515022 AAGTATAATTAAGTGTTTACAGG - Intergenic
1177372866 21:20228366-20228388 AAGCAGATGTAATTGTTTTCAGG - Intergenic
1177375620 21:20267261-20267283 AAGTAGAACTAATTGTTCTCAGG + Intergenic
1177908024 21:26995316-26995338 AAGTGGAAGTGATTGCTTTGAGG + Intergenic
1178609168 21:34065604-34065626 AAGTATAAGAAATAGTTTACAGG - Intergenic
1180901891 22:19379324-19379346 AAGTAGAAATACTTGATTTCCGG + Intronic
1184945470 22:47800655-47800677 ATGTATAAGTAATTCATTTGGGG - Intergenic
950986389 3:17373316-17373338 TGGTATAATTAATTGCTTTCTGG - Intronic
953247346 3:41206650-41206672 AAGTATAATTAAGTGGTTTTGGG + Intronic
957699909 3:83695478-83695500 AAGTATAATTAAATGATTTTTGG - Intergenic
958027311 3:88063673-88063695 AAGTATCAGGAATTGCATTTTGG + Intronic
958699971 3:97576306-97576328 AAGTAGAAGTAGTTGCTCCCTGG - Intronic
959187049 3:103057603-103057625 AACTACAAGTTACTGCTTTCAGG - Intergenic
959752148 3:109850342-109850364 AAATATAAGTAATGGATTTAGGG + Intergenic
962756082 3:138466530-138466552 ATGTATTAGTAACTGATTTCAGG + Intronic
963360981 3:144271571-144271593 ATGGATCAGGAATTGCTTTCTGG + Intergenic
964289504 3:155161790-155161812 AAGTCTAAGCTAATGCTTTCTGG + Intronic
964498405 3:157320428-157320450 ATGTTTATGTGATTGCTTTCAGG - Intronic
965331972 3:167386647-167386669 AATTATAAATAATTGTTTGCTGG - Intergenic
965383528 3:168018911-168018933 AAGCCTAAGTATTTGCTATCTGG - Intronic
965750869 3:171973872-171973894 AGGAAGAAATAATTGCTTTCTGG - Intergenic
966162166 3:176980048-176980070 ATGTATAAGGAGTTGCTATCAGG + Intergenic
966423481 3:179756862-179756884 AAGAGAAAGTAATAGCTTTCAGG - Intronic
967079602 3:186037077-186037099 AAGTTTTAGTAAAGGCTTTCTGG + Intergenic
967545818 3:190726051-190726073 AAGGAAAAATAATTTCTTTCTGG + Intergenic
970807932 4:20057561-20057583 AAGTAAAAGGATTTGCTGTCTGG + Intergenic
970915034 4:21322229-21322251 AAATATAAGAAATAGATTTCTGG + Intronic
971089855 4:23329063-23329085 AAGTCTTAGTATTTGCTCTCAGG + Intergenic
972292945 4:37707516-37707538 ATGTTTAAGTTATTGCTGTCAGG - Intergenic
973101469 4:46277015-46277037 AAGTATATGCAATTGTTTTTTGG - Intronic
974348166 4:60709220-60709242 ATGAAAAAGTAATTGCTTTTGGG - Intergenic
974422843 4:61700242-61700264 AAGTATACATAATTACTTTAAGG + Intronic
975343800 4:73271329-73271351 AAGTTTAAGTTATTGATTTAGGG + Intergenic
975745142 4:77468033-77468055 AAAAATAAGTAAATCCTTTCTGG + Intergenic
978272816 4:106911821-106911843 TAGAAAAAGTAATTCCTTTCTGG - Intergenic
979111542 4:116763061-116763083 AATTCAAAGTAATTGTTTTCAGG + Intergenic
979460275 4:120974522-120974544 TAGTAGAAGAAATTACTTTCAGG + Intergenic
979956820 4:126963717-126963739 AAGTATAAATTATTGCATTTGGG - Intergenic
980350559 4:131678340-131678362 AGGTAGAAGTTATTGCTTTTAGG - Intergenic
981117693 4:141011161-141011183 AAGTAAAATTGCTTGCTTTCCGG - Intronic
981950391 4:150399677-150399699 AGGTATAATTAAAGGCTTTCTGG + Intronic
984005102 4:174296082-174296104 GATTATAAGTAATTCCTCTCAGG + Intronic
984191966 4:176616580-176616602 AATTAAAAATAATTGCATTCTGG + Intergenic
984571093 4:181395037-181395059 AAGTAGAAGTAAATTCTTTAAGG - Intergenic
984689065 4:182704987-182705009 AAGAATATGTAATTGTTTTATGG + Intronic
987986224 5:25150917-25150939 ACTTATAATTAATTGCTCTCTGG + Intergenic
988203031 5:28093874-28093896 ATATATTAGTAATTGCTTTATGG - Intergenic
990178174 5:53130384-53130406 AAGAATGGGTGATTGCTTTCTGG + Intergenic
990661498 5:58020777-58020799 AAGTTGAAGTGATAGCTTTCAGG + Intergenic
991540900 5:67726982-67727004 AAGTATAAGTTCTTGAATTCTGG + Intergenic
992729154 5:79640787-79640809 ATGTAAAAGTAATTGCTATATGG - Intronic
992877801 5:81075171-81075193 CAGTATAAGTAGTTGGATTCTGG + Intronic
993839428 5:92858731-92858753 ATATATAAGTAATTGCATTATGG + Intergenic
993979311 5:94525344-94525366 AAGTTTAAGTAAAAGTTTTCAGG + Intronic
994357801 5:98813665-98813687 AGGTTTAAGTGATTGCTTTTGGG + Intergenic
994401306 5:99283687-99283709 AAGTAAAATTTATGGCTTTCAGG + Intergenic
994579928 5:101628981-101629003 AAGCACAAGTTATTGCTTTAGGG + Intergenic
995228334 5:109729056-109729078 AAATATAAATAACTGCTTTTTGG + Intronic
996243461 5:121230072-121230094 AAAAAAAAGTAATTGCTTTTGGG + Intergenic
996619654 5:125484676-125484698 AAGTAGAAATAAGTGTTTTCTGG - Intergenic
998821023 5:146058061-146058083 AAGTGTGAGCAATTGCTTTCAGG - Intronic
999699443 5:154214869-154214891 GAGTTTAAGTAATTGCTCTGAGG - Intronic
999837468 5:155389983-155390005 AATTATAGGTAATTTCTTCCTGG - Intergenic
999855772 5:155592099-155592121 AAGCATAAATATTTGCTATCAGG - Intergenic
999901675 5:156092594-156092616 AAGGGTAAGTAATTGCATTTGGG - Intronic
1001330317 5:170757563-170757585 AAGTGTAAGCAATTGCTCTCTGG + Intergenic
1001426002 5:171623137-171623159 ATCTATATGTAATTCCTTTCTGG + Intergenic
1002403805 5:179012570-179012592 AAGTACAAGTAACTGCTTAGAGG - Intergenic
1002876346 6:1213991-1214013 AAGTATAAGTAATAGGTTAATGG + Intergenic
1003344142 6:5250580-5250602 AAGTCTAAGAAACTGCTTTTAGG + Intronic
1004042294 6:11992290-11992312 AAGTACAGGTAATTGCCTCCAGG + Intergenic
1005178896 6:23080807-23080829 AAGTATAATGAAGTGCTTGCAGG + Intergenic
1009319400 6:62267769-62267791 AAGTATAAAAAGATGCTTTCAGG + Intronic
1009319961 6:62275583-62275605 AAATTTAAGGAATTGTTTTCTGG - Intronic
1009345397 6:62608446-62608468 AAGTATCAGTAGTTGTTTTTTGG + Intergenic
1009569331 6:65361779-65361801 TAGTCTAAGAAATTACTTTCAGG - Intronic
1010298469 6:74229714-74229736 AATTATGGGTAATTGCTTCCAGG + Intergenic
1010966220 6:82212380-82212402 AGGTATAATTAATTGGTTTGGGG + Intronic
1012592003 6:100993315-100993337 AAGCAAAAGTAAATTCTTTCAGG - Intergenic
1013004177 6:106056069-106056091 AATTAAAAGTAAATCCTTTCAGG + Intergenic
1015309199 6:131747008-131747030 AAATATAAGTGATTTTTTTCTGG + Exonic
1016502751 6:144740471-144740493 AAGTATAAGTAATTGCTTTCAGG + Intronic
1017988736 6:159468020-159468042 AAGTATCTGTCATTGCTTTGGGG - Intergenic
1018151921 6:160947602-160947624 AAGTATTTGCTATTGCTTTCTGG + Intergenic
1019016160 6:168881216-168881238 AAGAATAAGTGTTTGCTCTCAGG - Intergenic
1020195688 7:6036872-6036894 GAGTATAAGTACTTTTTTTCAGG - Intronic
1020849493 7:13333045-13333067 AAAAATAAGTGATTGCTTTGTGG + Intergenic
1022183920 7:27948536-27948558 AATGATAAGTCATTGCTGTCAGG - Intronic
1022346077 7:29515920-29515942 ATGCTTAAGTAATTGCTGTCAGG - Intergenic
1022930542 7:35107920-35107942 AAGTATCAGTAGTTACTTTCAGG - Intergenic
1023444423 7:40216950-40216972 AAGTGTAAGTATTTTCTTTGTGG + Intronic
1023731923 7:43200211-43200233 AAGTATAACTAATGCCATTCAGG - Intronic
1024377922 7:48659907-48659929 AAGTAGGAGAAATTGCTTCCAGG + Intergenic
1026410816 7:70119914-70119936 AAGTACTAGTATTTTCTTTCTGG - Intronic
1026437355 7:70411163-70411185 AATTAAAAATAATTGATTTCTGG - Intronic
1026442453 7:70456268-70456290 AAGTAAAAGTAAAAGCTTTTAGG - Intronic
1026941809 7:74291370-74291392 AAGGAGCAGTAATCGCTTTCCGG + Intronic
1028399905 7:90413819-90413841 AAATATAAGAAATTTATTTCAGG + Exonic
1028813280 7:95113682-95113704 CAGGATAGGTAAATGCTTTCTGG - Intronic
1028903940 7:96132351-96132373 ATGTATGTGTAATTTCTTTCTGG - Intronic
1029235603 7:99115043-99115065 AAGTTTAGGTTATTGATTTCAGG - Intronic
1029826438 7:103200432-103200454 AAGTATCAGTAGTTACTTTCAGG - Intergenic
1030034803 7:105399977-105399999 GAGTATAAGAATTTGCTTGCCGG + Intergenic
1030857854 7:114583626-114583648 AAGAATAAATTATTCCTTTCAGG + Intronic
1031062148 7:117063899-117063921 TAGTATAAGTAATGCCTGTCGGG - Intronic
1032532516 7:132634003-132634025 ATGTTTAAGTTATTGCTGTCAGG - Intronic
1033800373 7:144894282-144894304 AAGTATAGGAACTGGCTTTCAGG - Intergenic
1033944135 7:146694033-146694055 AAGTATGAATATTTGCTTCCTGG + Intronic
1034056747 7:148043350-148043372 AAGAATATGTATTTGCTTCCTGG - Intronic
1035009395 7:155700051-155700073 AATTAAAAGTAATTTCTTTGTGG - Intronic
1036088276 8:5637058-5637080 TAGTCTCAGTAATTGCTTTTTGG - Intergenic
1037409616 8:18582619-18582641 AAGTATGCATAATTGCTTACTGG + Intronic
1039101029 8:33942388-33942410 AAGGATGAGAAATTGCTTACTGG + Intergenic
1040838720 8:51760825-51760847 AAGTTTAAGTGATTTCCTTCAGG - Intronic
1041444124 8:57931636-57931658 AAGTATAAACAAATGATTTCAGG + Intergenic
1042234430 8:66595177-66595199 AAAAATAAGTAATTGTTTTGGGG - Intronic
1042315000 8:67416865-67416887 AAGCAAAAGTCACTGCTTTCTGG + Intergenic
1043047186 8:75341414-75341436 AAGTATTAGTCAATGCTTACAGG - Intergenic
1043176341 8:77027177-77027199 AAGTACATGTAATTCCTTTTGGG - Intergenic
1043979076 8:86617359-86617381 AAGTATAAGCAATGGTCTTCAGG + Intronic
1044020615 8:87101812-87101834 AAGTATAAGGCAGTGCTTTGAGG + Intronic
1044248089 8:89974334-89974356 TAGTATTAGTAATTTTTTTCAGG - Intronic
1044282570 8:90373724-90373746 AAGTATCAGTAATTGCTGTAAGG + Intergenic
1044382384 8:91549550-91549572 GACTTTAAGAAATTGCTTTCTGG - Intergenic
1044438592 8:92195705-92195727 AATTAAAAGTAGTTGCTTTTGGG - Intergenic
1044727086 8:95202766-95202788 ACTTATAAGTTATTTCTTTCTGG + Intergenic
1045585155 8:103526324-103526346 AAGCAAAAGTAAATTCTTTCTGG + Intronic
1046036281 8:108845288-108845310 AATCAGAAGTAAATGCTTTCTGG + Intergenic
1046116571 8:109791630-109791652 AAGAGTAAGTGATTGCTTTAAGG - Intergenic
1046507537 8:115155230-115155252 AATTAGACGTAATTTCTTTCAGG + Intergenic
1047099284 8:121658318-121658340 AAGTTGAAGTAATTTCCTTCTGG + Intergenic
1053077582 9:35147067-35147089 AAGTTTGAGTAATTGCTTCAGGG + Intergenic
1053782148 9:41621359-41621381 AGGTAGAAGTTATTGCTTTTAGG + Intergenic
1054170098 9:61831514-61831536 AGGTAGAAGTTATTGCTTTTAGG + Intergenic
1054667440 9:67749301-67749323 AGGTAGAAGTTATTGCTTTTAGG - Intergenic
1055335432 9:75229006-75229028 ATGCTTAAGTTATTGCTTTCAGG - Intergenic
1056474219 9:86937605-86937627 AAGTATAGGTAATGGTTGTCAGG + Intergenic
1057956264 9:99410545-99410567 AATTCAAAGTATTTGCTTTCGGG + Intergenic
1058408992 9:104709507-104709529 AAGTGTAAGGATTTGATTTCCGG + Intergenic
1060040217 9:120294020-120294042 AAGTATAAGTAGGTGTTTCCAGG + Intergenic
1060838865 9:126778711-126778733 CAGTACAAATAAATGCTTTCAGG + Intergenic
1061637055 9:131918669-131918691 AAGCAGAAGGAGTTGCTTTCAGG - Intronic
1061878988 9:133559226-133559248 CAGGATAAGTAAGTCCTTTCAGG - Intronic
1186018208 X:5223697-5223719 AAGTATAAGGCATTGTCTTCAGG + Intergenic
1186204748 X:7189797-7189819 AAGTAGTAATAATTGCTATCTGG + Intergenic
1187741345 X:22359069-22359091 AAGTAAACACAATTGCTTTCTGG - Intergenic
1187768742 X:22671600-22671622 AAGAATGGGTAAGTGCTTTCTGG - Intergenic
1188816578 X:34722359-34722381 AAGCATAAACAAATGCTTTCCGG + Intergenic
1192058488 X:67798349-67798371 AAATGTAAGAAATTACTTTCTGG + Intergenic
1192368425 X:70494467-70494489 ATGTGTAAGTCATTGCTATCTGG + Intronic
1192614091 X:72599911-72599933 AAGTACAAATAATTGTTTCCTGG - Intronic
1193676392 X:84458251-84458273 AAGTAAAACCAGTTGCTTTCTGG - Intronic
1193961948 X:87937161-87937183 AATAATAAGTAATTTTTTTCTGG + Intergenic
1194735502 X:97508100-97508122 CAGTACAAGAAATTGCTTGCTGG - Intronic
1199155584 X:144544112-144544134 AAATTTCAGTAAGTGCTTTCTGG + Intergenic
1201529704 Y:14978304-14978326 AAAGATAAGTAATTGCTTTTGGG - Intergenic
1201577438 Y:15476440-15476462 AAGTAGTAATAATTGCTATCTGG + Intergenic
1202277754 Y:23142975-23142997 GAGTAAAATTATTTGCTTTCAGG - Intronic
1202287449 Y:23265792-23265814 GAGTAAAATTATTTGCTTTCAGG + Intronic
1202287614 Y:23268176-23268198 GAGTAAAATTATTTGCTTTCAGG + Intronic
1202287779 Y:23270561-23270583 GAGTAAAATTATTTGCTTTCAGG + Intronic
1202287943 Y:23272945-23272967 GAGTAAAATTATTTGCTTTCAGG + Intronic
1202288108 Y:23275329-23275351 GAGTAAAATTATTTGCTTTCAGG + Intronic
1202288273 Y:23277713-23277735 GAGTAAAATTATTTGCTTTCAGG + Intronic
1202305975 Y:23471491-23471513 AAAAATAAGTAATGTCTTTCTGG + Intergenic
1202439389 Y:24883849-24883871 GAGTAAAATTATTTGCTTTCAGG + Intronic
1202439553 Y:24886234-24886256 GAGTAAAATTATTTGCTTTCAGG + Intronic
1202439718 Y:24888619-24888641 GAGTAAAATTATTTGCTTTCAGG + Intronic
1202439883 Y:24891003-24891025 GAGTAAAATTATTTGCTTTCAGG + Intronic
1202440048 Y:24893388-24893410 GAGTAAAATTATTTGCTTTCAGG + Intronic
1202564834 Y:26199098-26199120 AAAAATAAGTAATGTCTTTCTGG - Intergenic